<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="uk">
		<id>http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Cottonarcher3</id>
		<title>HistoryPedia - Внесок користувача [uk]</title>
		<link rel="self" type="application/atom+xml" href="http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Cottonarcher3"/>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=%D0%A1%D0%BF%D0%B5%D1%86%D1%96%D0%B0%D0%BB%D1%8C%D0%BD%D0%B0:%D0%92%D0%BD%D0%B5%D1%81%D0%BE%D0%BA/Cottonarcher3"/>
		<updated>2026-07-03T06:45:10Z</updated>
		<subtitle>Внесок користувача</subtitle>
		<generator>MediaWiki 1.24.1</generator>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Tained_the_recombination_occasion_observed_inside_the_passage_411_population_and_the&amp;diff=253533</id>
		<title>Tained the recombination occasion observed inside the passage 411 population and the</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Tained_the_recombination_occasion_observed_inside_the_passage_411_population_and_the&amp;diff=253533"/>
				<updated>2017-11-15T22:19:20Z</updated>
		
		<summary type="html">&lt;p&gt;Cottonarcher3: Створена сторінка: [http://notmydrama.com/members/rhythmcycle7/activity/378089/ Lationship was underpinned by appeals to universality: it was observed as] Sequencing towards the t...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;[http://notmydrama.com/members/rhythmcycle7/activity/378089/ Lationship was underpinned by appeals to universality: it was observed as] Sequencing towards the telomere and across the BTS revealed two sequences coincident with a six nucleotide repeat, which can be underlined for clarity.six SIM.Z. Anderson, et al.7 SITable S1 Primers utilised in this studyPrimer Sequence pan-TLO amplification ATGCCAGAAAACCTCCAAAC RL-arm Sequencing GGAGTACAGAAGTAGAGCAA RR-arm Sequencing AAAGCATCTGTAGACACGGC 1L-arm Sequencing CGCTGGGTATCACAAGAGTG 1R-arm Sequencing TCACCAAGACTGGGTAGAGC 2L-arm Sequencing GGGGTATTTGGAATGGTTTG 3L-arm Sequencing CCTATACATAGCCTTCTGCG 3R-arm Sequencing CTGTGGTGGCAGGTAATTTT 4L-arm Sequencing CCCACAAATATTTGTTCACC 4R-arm Sequencing CATTATTGTGTTTGGTGGGG 5L-arm Sequencing ATGTCTTCGACGGTATTGCC 5R-arm Sequencing TGTTCACCTTTGACATGCTC 6L-arm Sequencing TTTCTGGCCTCCTCTGCCTT 6R-arm Amplification AGAGTGTGACGATGAGGATGATAGCTG 7L-arm Amplification AGTTCTGGCTAGCTTATATTTTGCATCTCTATATCG 7R-arm Sequencing CAGGTGTTCGCTGTCTATTC CEN1 -L Amplification CATCCGTATTTCACACACGC CEN1 -R Amplification AACACAATGGTCCCACAACG CEN1 -R Sequencing AGACAATCCATAGGACCCTC CEN2 -L Amplification GAGTGAGTTAAGCTACCCAG CEN2 -R Amplification TTATCACCTTTGGTTCCCTG CEN2 -R Sequencing CCCTCGTTGTGACGTTTTAG CEN3 -L Amplification GCC.Tained the recombination occasion seen inside the passage 411 population and the remaining colony retained the TLO configuration observed in passage 380.M.Z. Anderson, et al.three SIFraction of strains Fraction of Strains0.0.20.0.Number of recombination events Quantity of MovementsFigure S3 Distribution of recombination events. The fraction of strains encoding unique numbers of recombination events was plotted (grey bars) and followed a Poisson distribution centered on the typical number of recombination events per strain (0.five). 1 strain, YJB9929, deviated from the random distribution and encoded six separate recombination events.4 SIM.Z. Anderson, et al.ChrR Chr1 Chr2 Chr3 Chr4 Chr5 Chr6 ChrTLO1 TLO3 TLO34 TLO5 TLO7 TLO9 TLO11 TLO5x 2x 2xTLO2 TLO4 TLOTLO8 TLO10/TLO9 TLOTLO  TLO  TLOTLO BTSTLOFigure S4 Organization of BTS components in the C. albicans genome. A cartoon depicts the location in the thirteen subtelomeric TLO genes and the BTS sequence element inside the parent strain [https://dx.doi.org/10.1038/srep18714 title= srep18714] for all passaged isolates. TLO genes plus the BTS are colour coded by clade as indicated.M.Z. Anderson, et al.five SITLO9 TLOChr 4RChr 4R/Chr 4LBase Call:Homolog 1: Homolog 2:...ATGTGTAGCCAACAAATAAAGAACGG......ATTGCAATTTAAAGTAGTTGGCCGTTAAGCTAG... ...ATGTGTAGCCAACAAATAAAGAACGGATTGCAATTGCAATTTAAAGTAGTTGGCCGTTAAGCTAG...Good quality:centromere......TLO9/10 ...telomereFigure S5 SC5314 encodes allelic TLO9 and TLO10 on Chr4R. The TLO locus on Chr4R inside the parental isolates encodes a heterozygous locus with TLO9 on 1 homolog and TLO10 around the other homolog. Sequencing towards the telomere and across the BTS revealed two sequences coincident having a six nucleotide repeat, which can be underlined for clarity.six SIM.Z. Anderson, et al.AYJB9929s - ChrRSNP: Position (Kb): 12 359 16BYJB9929s - ChrSNP: Position (Kb): 156 85 367 786 96 95 1186300 bp uncut 200 bp [https://dx.doi.org/10.3389/fnins.2015.00094 title= fnins.2015.00094] one hundred bp 300 bp reduce 200 bp 100 bpPassage: 425 457 SNP: 12 16 12Passage: one hundred SNP: 156 85 96700 bp156 85 96156 85 96 95 156 85 96uncut 300 bp200 bp 100 bp 700 bpcut 300 bp200 bp 100 bpFigure S6 Chromosome heterozygosity following subtelomeric LOH. The allelic state of chromosomes with altered TLO configurations but lacking a defined subtelomeric recombination web-site have been assayed by SNP-RFLP. Heterozygosity of ChrR (A) or Chr4 (B) in strain YJB9929s was assayed for both chromosome arms working with previously identified SNP-RFLP positions (FORCHE et al. 2009) in the noted chromosomal positions. Both chromosomes were heterozygous for all positions tested at all time points.M.Z. Anderson, et al.7 SITable S1 Primers applied within this studyPrimer Sequence pan-TLO amplification ATGCCAGAAAACCTCCAAAC RL-arm Sequencing GGAGTACAGAAGTAGAGCAA RR-arm Sequencing AAAGCATCTGTAGACACGGC 1L-arm Sequencing CGCTGGGTATCACAAGAGTG 1R-arm Sequencing TCACCAAGACTGGGTAGAGC 2L-arm Sequencing GGGGTATTTGGAATGGTTTG 3L-arm Sequencing CCTATACATAGCCTTCTGCG 3R-arm Sequencing CTGTGGTGGCAGGTAATTTT 4L-arm Sequencing CCCACAAATATTTGTTCACC 4R-arm Sequencing CATTATTGTGTTTGGTGGGG 5L-arm Sequencing ATGTCTTCGACGGTATTGCC 5R-arm Sequencing TGTTCACCTTTGACATGCTC 6L-arm Sequencing TTTCTGGCCTCCTCTGCCTT 6R-arm Amplification AGAGTGTGACGATGAGGATGATAGCTG 7L-arm Amplification AGTTCTGGCTAGCTTATATTTTGCATCTCTATATCG 7R-arm Sequencing CAGGTGTTCGCTGTCTATTC CEN1 -L Amplification CATCCGTATTTCACACACGC CEN1 -R Amplification AACACAATGGTCCCACAACG CEN1 -R Sequencing AGACAATCCATAGGACCCTC CEN2 -L Amplification GAGTGAGTTAAGCTACCCAG CEN2 -R Amplification TTATCACCTTTGGTTCCCTG CEN2 -R Sequencing CCCTCGTTGTGACGTTTTAG CEN3 -L Amplification GCC.&lt;/div&gt;</summary>
		<author><name>Cottonarcher3</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Plasmodium_falciparum_by_structured_rearrangement_of_Var_genes_in_the_course_of_mitosis._PLoS&amp;diff=252488</id>
		<title>Plasmodium falciparum by structured rearrangement of Var genes in the course of mitosis. PLoS</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Plasmodium_falciparum_by_structured_rearrangement_of_Var_genes_in_the_course_of_mitosis._PLoS&amp;diff=252488"/>
				<updated>2017-11-11T11:52:25Z</updated>
		
		<summary type="html">&lt;p&gt;Cottonarcher3: Створена сторінка: Kim, 2005 Telomere hypervariability in Magnaporthe oryzae. Mol. Plant Pathol. six: 287--298. Fischer, K., P. Horrocks, M. Preuss, J. Wiesner, S. Wunsch et al.,...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Kim, 2005 Telomere hypervariability in Magnaporthe oryzae. Mol. Plant Pathol. six: 287--298. Fischer, K., P. Horrocks, M. Preuss, J. Wiesner, S. Wunsch et al., 1997 Expression of var genes located inside polymorphic subtelomeric domains of Plasmodium falciparum chromosomes. Mol. Cell. Biol. 17: 3679--3686. Forche, A., M. Steinbach, and J. Berman, 2009 Efficient and fast identification of Candida albicans allelic status using SNP-RFLP. FEMS Yeast Res. 9: 1061--1069. Fukasawa, R., T. Tsutsui, Y. Hirose, A. Tanaka, and Y. Ohkuma, 2012 Mediator CDK subunits are platforms for interactions with numerous chromatin regulatory complexes. J. Biochem. 152: 241--249. Gardner, M. J., N. Hall, E. Fung, O. White, M. Berriman et al., 2002 Genome sequence of the human malaria parasite Plasmodium falciparum. Nature 419: 498--511. Gaut, B. S., S. I. Wright, C. Rizzon, J. Dvorak, and L. K. Anderson, 2007 Recombination: an underappreciated aspect within the evolution of plant genomes. Nat. Rev. Genet. eight: 77--84. Gemayel, R., M. D. [http://brantzegfamily.com/members/lace9hoe/activity/128815/ T consistently to create and agree the emerging themes of specificRich] Vinces, M. Legendre, and K. J. Verstrepen, 2010 Variable tandem repeats accelerate evolution of coding and regulatory sequences. Annu. Rev. Genet. 44: 445--477.Glover, L., S. Alsford, and D. Horn, 2013 DNA break website at fragile subtelomeres determines probability and mechanism of antigenic variation in African trypanosomes. PLoS Pathog. 9: e1003260. Gottschling, D. E., O. M. Aparicio, B. L. Billington, and V. A. Zakian, 1990 Position impact at S. cerevisiae telomeres: reversible repression of Pol II transcription. Cell 63: 751--762. Gresham, D., M. M. Desai, C. M. Tucker, H. T. Jenq, D. A. Pai et al., 2008 The repertoire and dynamics of [http://www.020gz.com/comment/html/?417874.html R caesarean sections from ladies and to increased willingness to execute] evolutionary adaptations to controlled nutrient-limited environments in yeast. PLoS Genet. four: e1000303. Haber, J. E., 2000 Partners and pathwaysrepairing a doublestrand break. Trends Genet. 16: 259--264. Hahn, M. W., T. De Bie, J. E. Stajich, C. Nguy.Plasmodium falciparum by structured rearrangement of Var genes throughout mitosis. PLoS Genet. ten: e1004812. Corcoran, L. M., J. K. Thompson, D. Walliker, and D. J. Kemp, 1988 Homologous recombination inside subtelomeric repeat sequences generates chromosome size polymorphisms in P. falciparum. Cell 53: 807--813. Cuomo, C. A., U. Guldener, J. R. Xu, F. Trail, B. G. Turgeon et al., 2007 The Fusarium graminearum genome reveals a link between localized polymorphism and pathogen specialization. Science 317: 1400--1402. Deem, A., A. Keszthelyi, T. Blackgrove, A. Vayl, [https://dx.doi.org/10.1186/1471-244X-13-141 title= 1471-244X-13-141] B. Coffey et al., 2011 Break-induced replication is extremely inaccurate. PLoS Biol. 9: e1000594. Dreszer, T. R., G. D. Wall, D. Haussler, and K. S. Pollard, 2007 Biased clustered substitutions inside the human genome: the footprints of male-driven biased gene conversion. Genome Res. 17: 1420--1430. Dujon, B., D. Sherman, G. Fischer, P. Durrens, S. Casaregola et al., 2004 Genome evolution in yeasts. Nature [https://dx.doi.org/10.1038/srep18714 title= srep18714] 430: 35--44. Dunn, B., C. Richter, D. J. Kvitek, T. Pugh, and G. Sherlock, 2012 Evaluation from the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments. Genome Res. 22: 908--924. Edgar, R. C., 2004 MUSCLE: a various sequence alignment technique with decreased time and space complexity. BMC Bioinformatics five: 113. Fan, C., Y. Zhang, Y.&lt;/div&gt;</summary>
		<author><name>Cottonarcher3</name></author>	</entry>

	</feed>