<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="uk">
		<id>http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Fly78friend</id>
		<title>HistoryPedia - Внесок користувача [uk]</title>
		<link rel="self" type="application/atom+xml" href="http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Fly78friend"/>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=%D0%A1%D0%BF%D0%B5%D1%86%D1%96%D0%B0%D0%BB%D1%8C%D0%BD%D0%B0:%D0%92%D0%BD%D0%B5%D1%81%D0%BE%D0%BA/Fly78friend"/>
		<updated>2026-04-27T03:27:10Z</updated>
		<subtitle>Внесок користувача</subtitle>
		<generator>MediaWiki 1.24.1</generator>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Participate_in_the_study_and_who_was_not._The_physicians_had_been&amp;diff=295113</id>
		<title>Participate in the study and who was not. The physicians had been</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Participate_in_the_study_and_who_was_not._The_physicians_had_been&amp;diff=295113"/>
				<updated>2018-02-28T11:55:44Z</updated>
		
		<summary type="html">&lt;p&gt;Fly78friend: Створена сторінка: One more limitation of this study was that, even though we were influenced by Leventhal's selfregulation framework to frame our study questions, we did not use...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;One more limitation of this study was that, even though we were influenced by Leventhal's selfregulation framework to frame our study questions, we did not use this or any other formal theoretical framework to select our measures and create our questionnaire items. For example, it will be exciting to assess relationships among genetic and life-style causal beliefs to other illness perceptions, including private manage and consequences. Provided the numerous illnesses assessed, we were limited in the quantity of constructs we could measure in this study, nevertheless it could be intriguing to discover these added theoretical constructs in future investigation. An additional limitation was that we relied on self-reported weight status instead of actual BMI primarily based on measured height and weight. The limitations will need to become weighed against the strengths, which contain that that is certainly one of the initial studies to examine genetic and life-style causal beliefs about obesity and connected [http://darkyblog.joorjoor.com/members/bomberpolice01/activity/178626/ Rch Exchange Ontario. The authors would prefer to express due to] diseases amongst Hispanic and African American folks. Offered the preponderance of White Non-Hispanic people represented in both genomics analysis and social andAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptPublic Health Genomics. Author manuscript; available in PMC 2015 March 06.Sanderson et al.Pagebehavioral research on genomics difficulties, there is a need for a lot more studies in this field to consist of these generally under-represented racial and ethnic populations. This study makes a vital contribution towards the literature by which includes perspectives of Hispanic and African American people on difficulties relevant to genomics and obesity. Furthermore, even though Ashida et al. (2010) examined beliefs about heart illness, diabetes and also a person's weight [33], and whilst Sanderson et al. (2011) examined beliefs about heart disease and cancer [38], our study will be the initially to possess addressed causal beliefs about obesity, form 2 diabetes, heart disease and cancer simultaneously within a single study. Further research is needed to test the hypotheses recommended by the cross-sectional final results presented here. The findings want to become replicated inside a larger, a lot more representative sample of respondents.Participate in the study and who was not. The physicians have been instructed to method all potentially eligible individuals within the offered timeframe, but there might have nevertheless been some bias in whom they chose to inform about the study. There's no explanation to suspect that these style considerations would impact the relationships involving genetic and way of life causal beliefs observed within participants. On the other hand, they do emphasize that this study must be observed [https://dx.doi.org/10.1371/journal.pone.0077579 journal.pone.0077579] as exploratory. The findings want to become replicated in a bigger, additional representative survey of adults inside the general population, e.g. men and women recruited via the HINTS survey. A different limitation of this study was that, even though we were influenced by Leventhal's selfregulation framework to frame our research concerns, we didn't use this or any other formal theoretical framework to pick our measures and develop our questionnaire items. For instance, it will be intriguing to assess relationships between genetic and lifestyle causal beliefs to other illness perceptions, like individual manage and consequences. Given the various diseases assessed, we were limited in the quantity of constructs we could measure within this study, nevertheless it could be intriguing to discover these more theoretical constructs in future research.&lt;/div&gt;</summary>
		<author><name>Fly78friend</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Ent_SNPs_in_each_and_every_locus_before_the_designing_of_a&amp;diff=294846</id>
		<title>Ent SNPs in each and every locus before the designing of a</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Ent_SNPs_in_each_and_every_locus_before_the_designing_of_a&amp;diff=294846"/>
				<updated>2018-02-28T03:24:31Z</updated>
		
		<summary type="html">&lt;p&gt;Fly78friend: Створена сторінка: Samples with all the m.10398G allele were tested forMethods Ethics StatementThe study was [https://dx.doi.org/10.1371/journal.pone.0077579 journal.pone.0077579]...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Samples with all the m.10398G allele were tested forMethods Ethics StatementThe study was [https://dx.doi.org/10.1371/journal.pone.0077579 journal.pone.0077579] performed in line with the Spanish Law for Biomedical Investigation (Law 14/2007-3 of July) and complied with all the Declaration of Helsinki. The study plus the use of archive samples for this project have been [http://www.medchemexpress.com/Citarinostat.html ACY-241 chemical information] authorized by the Study Ethics [http://www.medchemexpress.com/Belinostat.html PXD101 chemical information] committee of Galicia. The National DNA Bank, which provided DNA samples, received the approval from their very own ethical committee. Written informed consent was obtained from all sufferers. All the samples were collected anonymously.Individuals and ControlsThis case-control followed STREGA guidelines [27]. DNA samples from 781 unrelated Spanish folks (423 healthful controls and 358 IC individuals) have been analysed within this study. The ischemic cardiopathy group included 225 individuals obtained from A [https://dx.doi.org/10.3389/fpsyg.2016.01503 fpsyg.2016.01503] Coruna University Hospital Cardiology Unit and 133 supplied   by the National DNA Bank (University of Salamanca, Spain). The handle group was an age and sex matched population of donors from A Coruna University Hospital Blood Bank. Primer sequences used for in multiplex PCR, SBE and PCR-RFLP.Polimorphic web page Multiplex PCRPCR primer 59-CTGACTGGCATTGTATTAGCA-39 59GTATACGGGTTCTTCGAATG-Position 6960F 7433RSNP analyzedRestriction enzime59-GAGAAGGCTTAGAAGAAAACCCCAC-39 59GTGGGCGATTGATGAAAAGGC-14601F 14950R59-GGCCTATGAGTGAACTACAAAA-39 59TATTCCTAGAAGTGAGATGGT-10364F 10526R59-CCTACCACTCACCCTAGCATTAC-39 59TAGGAATGCGGTAGTAGTTAG-4185F 5120R59-CAACCCCGACATCATTACCGGGT-39 59GGGTTAACGAGGGTGGTAAGG-12106F 12413R59-CCTACCACTCACCCTAGCATTAC-39 59GCGAGCTTAGCGCTGTGATGAG-4185F 4542RSingle Base Extensi on (SBE)59-ACACGACACGTAACTACGTTGTAGC-7004Fm.7028C.T14766 10398 4580 12308 4216 PCRRFLP59cgatcATGAGTGGTTAATTAATTTTATTAGGGTTA-39 59-ataTATGAGTGACTACAAAAAGGATTAGA CTGA-39 59-(at)7TTTTTTACCTGAGTAGGCCTAGAAA TAAACAT-39 59-(tacg)5aCCATTGGTCTTAGGCCCCAA-39 59-cgCCACTCACCCTAGCATTACTTATATG A-39 59-CTTTGGCTTCGAAGCCGCCGCC-39 59TATTCCTAGAAGTGAGATGGT-14798R 10368F 4548F 12288F 4189F 9902F 10526Rm.14766C.T m.10398A.G m.4580G.A m.12308A.G m.4216T.C m.10034T.C (2)AluI59-ATGCCTCAGGATACTCCTCAATAGCCAT C- 39 59CCGTGCGAGAATAATGATGTATGC-14430F 14686Rm.1470T.C(+)AccI59- TAGCCCACTTCTTACCACAAGGC-39 59GTGTGAAAACGTAGGCTTG-8900F 9172Rm.8994G.A(two)HaeIIIR: primer in reverse orientation; F:primer in forward orientation. *Lower case letters indicate the unspecific nucleotides in 59-end of your SBE primer. PCR solutions for RFLP analysis were digested using the corresponding restriction.Ent SNPs in each locus before the designing of a reference sequence encompassing all of the allelic variants for each and every locus. The PCR-RFLP assay was performed on those samples possessing no haplogroup assigned soon after the SBE assay. The samples have been amplified with all the corresponding primers (Table 1) and digested depending on the nucleotide localised at polymorphic web site 10398 (m.10398A.G). Samples using the m.10398G allele had been tested forMethods Ethics StatementThe study was [https://dx.doi.org/10.1371/journal.pone.0077579 journal.pone.0077579] performed as outlined by the Spanish Law for Biomedical Research (Law 14/2007-3 of July) and complied with the Declaration of Helsinki. The study along with the use of archive samples for this project have been authorized by the Study Ethics Committee of Galicia. The National DNA Bank, which supplied DNA samples, received the approval from their own ethical committee. Written informed consent was obtained from all patients. Each of the samples were collected anonymously.Sufferers and ControlsThis case-control followed STREGA recommendations [27]. DNA samples from 781 unrelated Spanish individuals (423 wholesome controls and 358 IC individuals) were analysed in this study. The ischemic cardiopathy group integrated 225 individuals obtained from A [https://dx.doi.org/10.3389/fpsyg.2016.01503 fpsyg.2016.01503] Coruna University Hospital Cardiology Unit and 133 provided   by the National DNA Bank (University of Salamanca, Spain). The manage group was an age and sex matched population of donors from A Coruna University Hospital Blood Bank.&lt;/div&gt;</summary>
		<author><name>Fly78friend</name></author>	</entry>

	</feed>