<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="uk">
		<id>http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Gatefifth8</id>
		<title>HistoryPedia - Внесок користувача [uk]</title>
		<link rel="self" type="application/atom+xml" href="http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Gatefifth8"/>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=%D0%A1%D0%BF%D0%B5%D1%86%D1%96%D0%B0%D0%BB%D1%8C%D0%BD%D0%B0:%D0%92%D0%BD%D0%B5%D1%81%D0%BE%D0%BA/Gatefifth8"/>
		<updated>2026-10-02T16:41:02Z</updated>
		<subtitle>Внесок користувача</subtitle>
		<generator>MediaWiki 1.24.1</generator>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Nse.Discussion_As_an_important_drought-tolerant_crop,_foxtail_millet_gives_an&amp;diff=284010</id>
		<title>Nse.Discussion As an important drought-tolerant crop, foxtail millet gives an</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Nse.Discussion_As_an_important_drought-tolerant_crop,_foxtail_millet_gives_an&amp;diff=284010"/>
				<updated>2018-02-05T04:51:40Z</updated>
		
		<summary type="html">&lt;p&gt;Gatefifth8: Створена сторінка: In this study, sit-miR167b was considerably upregulated under drought strain, and two target genes (Si021157m and Si000404m) encoding ARF genes had been identif...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;In this study, sit-miR167b was considerably upregulated under drought strain, and two target genes (Si021157m and Si000404m) encoding ARF genes had been identified depending on degradome sequencing. Recently, a study in soybeans showed that miR167 positively regulates nodules and lateral roots by repressing the target genes GmARF8a and GmARF8b (homologous genes of Arabidopsis AtARF8) [67], which indicated thatWang et al. BMC Genetics (2016) 17:Web page 11 ofFig. 7 microRNA-mediated regulatory networks. Targets of DE miRNAs homologous to Arabidopsis along with the constructed network determined by the Protein rotein Interaction information in the STRING database. Pink round rectangle represents the target identified by degradome sequencing, green ellipse represents the predicted target by psRNA Target, and also other proteins are shown as a gray circlemiR167 modulates root adaptation to [https://dx.doi.org/10.1089/jir.2013.0113 title= jir.2013.0113] drought tension. miR390 is yet another miRNA identified to be involved in drought tension. Inside the present study, miR390 was upregulated, which was consistent together with the outcomes in cowpeas [68] and Brachypodium distachyon [69]. It was reported that miR390 targets the TAS genes, which generates tasiRNAs (trans-acting modest interfering RNA) and regulates Auxin Response Factor (ARF) to modulate lateral root emergence and organ polarity establishment. These final results indicated that some miRNAs are conserved in response to drought across plants. On the other hand, as reported in earlier studies, some drought-related miRNAs show unique expression patterns in response to drought stress. One example is, miR156 was upregulated in cowpeas and barley in response to drought [http://www.medchemexpress.com/Chaetocin.html Chaetocin site] stress [68, 70], but it was downregulated in rice under conditions of drought. [27] Our final results showed that two members of miR156 (sit-miR156a and sit-miR156b) have been significantly upregulated, with more than 1 log2 fold adjust. In addition, a number of studies have shown that the expression of miR398 was induced by drought strain.Nse.Discussion As a vital drought-tolerant crop, foxtail millet provides a perfect technique to study drought tolerance. Escalating evidence has indicated that miRNAs play animportant part in plant in response to drought. Thinking about the importance of miRNAs, numerous miRNAs of foxtail millet happen to be identified by [https://dx.doi.org/10.1093/geronb/gbp074 title= geronb/gbp074] high-throughput sequencing and bioinformatics approaches [35?7]. Nonetheless, these research focused on complete genome scales, which can not reveal regulatory roles at the transcriptional level. Furthermore, compared with identified miRNAs from other species, for example Arabidopsis, maize, and rice, there have been fewer miRNAs in foxtail millet. The majority of foxtail millet-specific miRNAs, specially drought-related miRNAs, remain unidentified. Within the present study, we constructed two sRNA libraries (control and drought treatment) and identified conserved, novel miRNAs, too as drought-related miRNAs in foxtail millet.Drought-responsive miRNAFig. six A combined heat map on the negative correlation between a miRNA and its target in foxtail millet under drought stress. The red represents upregulated expression, and the green represents downregulated expressionComparisons of your expression levels of miRNAs inside the handle and drought libraries revealed that 18 miRNAs belonging to 16 miRNA families changed drastically. Of those miRNA families, some are thought to be linked with drought in other species, including miR159, miR167, and miR390. During the response to drought, miR167 was upregulated in Arabidopsis [23] and P. euphratica [50]. Within this study, sit-miR167b was considerably upregulated under drought strain, and two target genes (Si021157m and Si000404m) encoding ARF genes had been identified based on degradome sequencing.&lt;/div&gt;</summary>
		<author><name>Gatefifth8</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Nce_database._The_largest_fraction_of_unannotated_sequences_may_represent_novel&amp;diff=283342</id>
		<title>Nce database. The largest fraction of unannotated sequences may represent novel</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Nce_database._The_largest_fraction_of_unannotated_sequences_may_represent_novel&amp;diff=283342"/>
				<updated>2018-02-03T03:59:53Z</updated>
		
		<summary type="html">&lt;p&gt;Gatefifth8: Створена сторінка: Among them, 29 miRNA* have been [http://www.medchemexpress.com/Oroxylin-A.html Baicalein 6-methyl ether site] identified determined by sequence alignment. Compa...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Among them, 29 miRNA* have been [http://www.medchemexpress.com/Oroxylin-A.html Baicalein 6-methyl ether site] identified determined by sequence alignment. Comparable final results have been identified in other plant species [58].Identification of known miRNAsTo determine the known miRNAs of foxtail millet (conserved and species-specific), clean reads of two libraries were searched against mature plant miRNAs from the miRNA database.Nce database. The largest fraction of unannotated sequences could represent novel miRNAs as well as other classes of tiny ncRNAs. Comparable benefits have been found in other plant species [58].Identification of identified miRNAsTo recognize the identified miRNAs of foxtail millet (conserved and species-specific), clean reads of two libraries were searched against mature plant miRNAs from the miRNA database. Right after filtering miRNAs whose [https://dx.doi.org/10.1037/a0022827 title= a0022827] premiRNA could not kind hairpin secondary structures, 81 miRNAs were identified inside the CL and DT libraries,Fig. 1 Effects of drought anxiety on phenotypic alterations and changes in leaf water potential (WP) in foxtail millet seedlings. a Soon after drought treatment for 3 days, the plants had been smaller compared with control plants, as well as the leaves changed colour. b Leaf water prospective (LWP) of manage and drought therapy plants. Just after drought therapy, LWP decreased from -0.five Mp (CL) to -1.4 Mp (DT)Wang et al. BMC Genetics (2016) 17:Web page 5 ofTable 1 Statistical evaluation of typical and particular sRNAs in between manage (CL) and drought-treatment (DT) librariesType Total_sRNA CL   DT CL particular DT distinct Special sRNAs 3067712 363399 1124459 1579854 % ( ) one hundred.00   11.85   36.65   51.50   Total sRNAs 24498926 12839242 1284842 10374842 % ( ) one hundred.00   52.41   5.24   42.35which had been clustered into 28 households depending on the similarity of your mature miRNA sequence. Among them, 29 miRNA* were identified determined by sequence alignment. The length of pre-miRNA ranged from 66 to 222 nt and adverse MFEs (minimum free of charge energies) ranged from -32.1 to -98.9 kcal/mol (Further file three). Compared with the 48 foxtail millet miRNA households from a earlier report by Bennetzen et al. [59], the results showed that these miRNA families are frequent. Analysis of all known miRNA family members reads of two libraries showed that the number of reads varied drastically, ranging from 14 to 20,970 (1484.7 TPM) in the CL library and from 4 to 22,500 (2168.7 TPM) within the DT library. MIR166 was essentially the most abundant miRNA family members in both the CL and DT libraries. In contrast, MIR397 and MIR2118 showed low expression levels (Fig. three). According to evaluation of place of precursor, we identified that in foxtail millet, much more than 87   of identified miRNAs are derived from intergenic regions, and other individuals originate from coding sequence [https://dx.doi.org/10.1089/jir.2013.0113 title= jir.2013.0113] regions (Extra file three). This outcome was consistent with prior studies [60].Identification of potential novel miRNAs in foxtail milletmiRNA candidates have been obtained. The length of precursor miRNA sequences varied from 61 to 208 nt, plus the negative MFEs with the identified foxtail millet miRNA precursors varied from -18.0 to -111.8 kcal/mol (Added file 4). The secondary structures of novel miRNA precursors shown in Further file five. Among these possible miRNAs, eight miRNAs with complementary miRNA* were identified, which supported their part as novel miRNAs of foxtail millet (Table three). The majority of these miRNAs had reasonably low expression, which was constant with previous research in other plants [58, 59].&lt;/div&gt;</summary>
		<author><name>Gatefifth8</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=CGAGCAC_Arm_3p_5p_5p_3p_3p_5p_3p_5p_Length&amp;diff=282438</id>
		<title>CGAGCAC Arm 3p 5p 5p 3p 3p 5p 3p 5p Length</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=CGAGCAC_Arm_3p_5p_5p_3p_3p_5p_3p_5p_Length&amp;diff=282438"/>
				<updated>2018-01-31T09:28:34Z</updated>
		
		<summary type="html">&lt;p&gt;Gatefifth8: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;CGAGCAC Arm 3p 5p 5p 3p 3p 5p 3p 5p Length (nt) 22 21 21 21 21 21 21In foxtail millet, various miRNA [http://hsepeoplejobs.com/members/spaceeagle3/activity/607648/ CGAGCAC Arm 3p 5p 5p 3p 3p 5p 3p 5p Length] targets have already been predicted previously [35, 36], but couple of miRNA targets have been validated experimentally. Of those 26 target genes, ten were in category 2, 6 were in category three, 4 were in category four, 3 were in category 0 and 1.CGAGCAC Arm 3p 5p 5p 3p 3p 5p 3p 5p Length (nt) 22 21 21 21 21 21 21In foxtail millet, several miRNA targets have been predicted previously [35, 36], but few miRNA targets happen to be validated experimentally. To recognize miRNA targets in foxtail millet at the worldwide level, we employed the degradome sequencing method to recognize target genes for known miRNAs and candidate novel miRNAs. Raw sequencing information generated by degradome sequencing are out there at EMBL together with the accession number ERP014368. Just after removing adapter sequences and lowquality tags, we obtained a total of 11,762,879 clean reads (3,528,168 one of a kind reads) representing the 5' uncapped ends, of which 7,239,426 (2,433,599 distinctive reads) were perfectly matched for the S. italica genome. The reads that perfectly mapped to the genome were subjected to further evaluation working with PAREsnip software program [52]. In this study, 56 target genes for 12 known miRNA families [https://dx.doi.org/10.1038/srep43317 title= srep43317] had been identified. Depending on the abundance of degradome tags at the target sites, these cleaved targets have been classified into 5 categories; 42 target genes have been classified into category 0, 4 target genes into category 1, six target genes into category two, 2 target genes into category 3, and two target genes into category four (Table 4). The detailed information and facts is provided in More file 8, plus the t-plots for targets are illustrated in Further file 9. The majority of recognized miRNAs regulated multiple target genes (ranging from 1 to 11). Amongst them, the sit-miR156 family members, with 11 unique target genes, had the biggest number of target genes; the sit-miR172 and sit-miR393 families had only one [https://dx.doi.org/10.1089/jir.2011.0073 title= jir.2011.0073] target gene, and the other folks had two to eight targets. Functional evaluation of these target genes showed that they had been enriched in transcription components, like SBP-box transcription element (sit-miR156), MYB (sit-miR159), ARF (sit-miR160), NAC (sit-miR164), HD-zip transcription aspect (sitmiR166), GRAS (sit-miR171), and GRF (sit-miR396). These final results were consistent with a previous study in S. italica and also other species [8, 35]. Furthermore, we identified a total of 26 target genes for 9 novel miRNAs (Additional file eight, Extra file ten).miRNA* sequence ATGGTGTACCGGTTGTTATGC AGGCTAGGCTTGCGACTGGAG CCGTAGCCCCTGCTCCTGATG TGACAACGAGAGAGAGCA CGTGGTGTTGTTTCGGCTCATG TTGAGCCGTGCCAATATCACG TTAGCCAAGAATGACTTGCCTATC GCTCGCTCCTCTTTCTGTCAGCpercursor place scaffold_7:35210708..35210784:scaffold_14:67096..67179:scaffold_5:4967704..4967886:scaffold_8:21627028..21627140:+ scaffold_1:34236041..34236153:+ scaffold_7:30396911..30397013:scaffold_3:6158117..6158229:+ scaffold_4:31435223..31435323:+MFE -30.two -31.four -101.4 -71.2 -53.1 -50.three -49.two -66.Wang et al. BMC Genetics (2016) 17:Web page 7 ofFig. 4 Differential expression evaluation of conserved and novel drought-responsive miRNAs. a Fold modify (log2) in handle library relative to drought library detected by solexa tiny RNA sequencing. b The relative expression degree of miRNAs measured by RT-qPCR. * suggests important distinction in between control and drought tension at P  0.Unlike the targets of recognized miRNAs, most targets of novel miRNAs fell into category 2.&lt;/div&gt;</summary>
		<author><name>Gatefifth8</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=G_exons,_rRNA,_tRNA,_snoRNA,_snRNA,_and_recognized_miRNAs,_we_pooled&amp;diff=281999</id>
		<title>G exons, rRNA, tRNA, snoRNA, snRNA, and recognized miRNAs, we pooled</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=G_exons,_rRNA,_tRNA,_snoRNA,_snRNA,_and_recognized_miRNAs,_we_pooled&amp;diff=281999"/>
				<updated>2018-01-30T07:52:33Z</updated>
		
		<summary type="html">&lt;p&gt;Gatefifth8: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;A total of 72 novelTo identify drought-associated miRNAs of foxtail millet, we [http://www.sdlongzhou.net/comment/html/?202706.html He neighborhood it is actually not possible to perform with more objective] removed miRNAs whose expression levels had been too low to become analyzed for differential expression (sequencing frequency [https://dx.doi.org/10.1037/a0022827 title= a0022827] DT libraries) and compared the normalized expression of miRNAs amongst the CL and DT libraries. A total of 18 known miRNAs belonging to 16 families had been considerably expressed with far more than 1 log2 fold change (Extra file six). Among these DE miRNAs, 14 miRNAs (sit-miR1432-3p, sit-miR156a-5p, sit-miR156b-5p, sit-miR164a-5p, sit-miR167b-5p, sit-miR 171c-3p, sit-miR2118-3p, sit-miR390-5p, sit-miR394-5p, sit-miR395-3p, sit-miR408-3p, sit-miR529a-3p, sit-miR 529b-3p, and sit-miR827) were upregulated and 4 miRNAs (sit-miR159b-3p, sit-miR319c-5p, sit-miR528-5p and sit-miR535-5p) had been downregulated; a few of these miRNA families have already been associated with droughtTable two Statistical evaluation of sRNAs for manage (CL) and drought-treatment (DT) librariesCL (manage) Variety Exon antisense Exon sense Intron antisense Intron sense miRNA rRNA repeat tRNA other people Total Uniq sRNAs 137 394 34 225 8698 98782 10278 7782 1361528 1487858 Percent 0.01 0.03 0.00 0.02 0.58 six.64 0.69 0.52 91.51 one hundred.00 Total sRNA 141 491 35 252 117589 2310754 184428 217892 11292502 14124084 Percent 0.00 0.00 0.00 0.00 0.83 16.36 [https://dx.doi.org/10.1038/srep18714 title= srep18714] 1.31 1.54 79.95 one hundred.00 DT (drought-treatment) Uniq sRNAs 94 180 29 91 7814 118155 10425 9434 1433632 1579854 Percent 0.01 0.01 0.00 0.01 0.49 7.48 0.66 0.60 90.74 100.00 Total sRNA 95 191 29 93 104080 2026243 197797 152753 7893561 10374842 % 0.00 0.00 0.00 0.00 1.00 19.53 1.91 1.47 76.08 one hundred.Wang et al. BMC Genetics (2016) 17:Web page six ofTarget prediction of miRNAs and validation by degradome sequencingFig. 3 Expression levels of recognized miRNA families in CL and DT librariesstress in prior research: miR156 [31, 61], miR159 [23], miR167 [23, 61], miR395 [62], and miR408 [63]. We also identified three possible novel miRNAs deemed to become drought-response miRNAs depending on the differential expression between the CL and DT libraries. Of those miRNAs, two (sit-novel-miR10, sit-novelmiR56) were upregulated, and one particular (sit-novel-miR18) was downregulated (Added file 7). To verify the results of miRNA sequencing and bioinformatics evaluation, six known miRNAs (sit-miR159b, sit-miR167b, sit-miR390, sit-miR394, sit-miR396a, and miR408) and 4 novel miRNAs (sit-novel-miR15, sitnovel-miR18, sit-novel-miR53, and sit-novel-miR56) have been selected randomly for validation by qRT-PCR. The results showed that the fold transform of expression obtained by qRT-PCR was not absolutely constant with bioinformatics evaluation results, but the expression trend was similar (Fig. four). The stem-loop secondary structure of 4 novel miRNAs is shown in Fig. five. These benefits recommended that Solexa sequencing was successfully applied to determine drought-related miRNAs in foxtail millet.Table three Potential novel miRNAs with miRNA* discovered in S. italicamiRNA sit_novel_miR10 sit_novel_miR15 sit_novel_miR30 sit_novel_miR41 sit_novel_miR42 sit_novel_miR45 sit_novel_miR48 sit_novel_miR56 Mature Sequence GTATGGAAGAACTGCTGCGCCA CACTATAGGAGCTGGCCAGGT TTAGGCTCGGGGACTATGGTG GTGCTCCCTCCCGTTGTCACC [http://www.musicpella.com/members/wing16house/activity/483879/ Ggests that this asymmetry reflects a common property of face processing] TGAGCCGAACCAATATCACTC GGATATTGGTGCGGTTCAATC TGGTAGGCATTCTGGTTAAGT TTGACAGAAGAGAG.G exons, rRNA, tRNA, snoRNA, snRNA, and known miRNAs, we pooled the remaining unannotated sRNA sequences of two libraries and predicted novel miRNAs utilizing miRcat software program with default plant parameters and psRobot software.&lt;/div&gt;</summary>
		<author><name>Gatefifth8</name></author>	</entry>

	</feed>