<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="uk">
		<id>http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Lyric14mimosa</id>
		<title>HistoryPedia - Внесок користувача [uk]</title>
		<link rel="self" type="application/atom+xml" href="http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Lyric14mimosa"/>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=%D0%A1%D0%BF%D0%B5%D1%86%D1%96%D0%B0%D0%BB%D1%8C%D0%BD%D0%B0:%D0%92%D0%BD%D0%B5%D1%81%D0%BE%D0%BA/Lyric14mimosa"/>
		<updated>2026-08-04T13:51:32Z</updated>
		<subtitle>Внесок користувача</subtitle>
		<generator>MediaWiki 1.24.1</generator>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Gilteritinib_Clinical_Trials&amp;diff=240050</id>
		<title>Gilteritinib Clinical Trials</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Gilteritinib_Clinical_Trials&amp;diff=240050"/>
				<updated>2017-10-09T10:53:56Z</updated>
		
		<summary type="html">&lt;p&gt;Lyric14mimosa: Створена сторінка: Th strands [https://www.medchemexpress.com/GNE-7915.html GNE-7915 manufacturer] employing an Applied Biosystems 3500xls Dx Genetic Analyzer and primers in the s...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Th strands [https://www.medchemexpress.com/GNE-7915.html GNE-7915 manufacturer] employing an Applied Biosystems 3500xls Dx Genetic Analyzer and primers in the second PCR. The sequences from the study are out there in GenBank beneath accession numbers KC899326 C899346.RT Ultra-deep PyrosequencingRT UDPS was performed working with the Roche GS Junior equipment. Amplicons previously obtained, purified and quantitated were pooled at equimolar concentrations. Clonal amplification on beads (EmPCR) was performed employing the 454 Life Science reagents that allow bidirectional sequencing, composed of 30 cycles of PCR amplification. DNA-containing beads had been recovered and UDPS was performed around the GS Junior sequencer (454 Life Sciences; Roche). UDPS generated a median of 11.000 sequence reads per sample. These reads had been analyzed working with the Amplicon Variant Analyzer application, 454, Roche. The UDPS results in the study are obtainable in GenBank beneath accession quantity SRA073324.Toward a brand new Idea of HIV VaccineTable four. Primers made use of for Gag, Nef and Pol amplification.sequence 59-39 GAG Initial PCR 1 amplicon Primer 59 Primer 39 1st PCR 2nd amplicon Primer 59 Primer 39 Second PCR 1st amplicon Primer 59 Primer 39 Second PCR 2nd amplicon Primer 59 Primer 39 Second PCR 3rd amplicon Primer 59 Primer 39 Second PCR 4th amplicon Primer 59 Primer 39 NEF 1st PCR Primer 59 Primer 39 Second PCR Primer 59 Primer 39 POL Very first PCR Primer 59 Primer 39 Second PCR 1st amplicon Primer 59 Primer 39 Second PCR 2nd amplicon Primer 59 Primer 39 Second PCR 3rd amplicon Primer 59 [http://www.ncbi.nlm.nih.gov/pubmed/18204824 18204824] Primer 39 doi:10.1371/journal.pone.0069029.t004 CTRGATGTGGGTGATGCA CNYTATAGGCTGTACTGTCC GAAAATCCATACAATACTCCAGTATTTGC CTATGCTGCCCTATTTCTAAGTCAGAT TTGGTTGCACTTTAAATTTTCCCATTAGCCCTATT CTTTCCATCCCTGTGGAAGCACATT AGTAGGACCTACACCTGTCA CTGTTAGTGCTTTGGTTCCTCT CCTAGAAGAATAAGACAGGGCTTGGAAAG ACGCCTCCCTGGAAAGTCCCCAGCGG GCCACAGCCATAGCAGTAGCTGAGGGG CCAGTACAGGCAAAAAGCAGCTGCTTATA TCAGAGCAGACCAGAGCCAACAGCCCCA AATGCTTTTATTTTTTCTTCTGTCAATGGC ATAATCCACCTATCCCAGTAGGAGAAATT AGGGGTCGTTGCCAAAGA CACCTAGAACTTTAAATGCATGGGT TTTGGTCCTTGTCTTATGTCCAGA GACTAGCGGAGGCTAGAA GTTCTAGGTGATATGGCCTGATG ATAATCCACCTATCCCAGTAGGAGAAATT ATGCTTTTATTTTTTCTTCTGTCAATGGC GACTAGCGGAGGCTAGAA TTTGGTCCTTGTCTTATGTCCAGAstHXB2 genome position764?81 1635?1544?572 2621?764?81 1219?1232?256 1635?1544?572 2264?2136?163 2621?8673?699 9511?8754?782 9443?2480?499 3399?2530?564 2988?2706?734 3119?2874?891 3284?HLA Class I TypingGenomic DNA was extracted from the frozen white blood cell pellets and quantitated as described above. Intermediate-to-high resolution was performed by reverse Polymerase Chain ReactionSequence Particular Oligonucleotide (PCR-SSO) hybridization utilizing the LuminexH flow beads LabTypeH assay (InGen, Chilly-Mazarin, France) for the A and B loci. Allelic ambiguities were solved with PCR-Sequence Specific Primer (SSP) amplification applying Olerup assays (BioNoBis, Montfort L'Amaury, France). The manufacturers' recommendations had been strictly followed. Allele assignment was performed by comparison together with the official nomenclature and validated by the WHO committee for HLA technique factors.Immune Recognition ToolsThe viral epitopes regarded as for the study were those in the Los Alamos database. Recognition involving the HLA groove along with the peptides or their variants was predicted  making use of the immune epitope database (www.immuneepitope.org). We evaluated the affinity of the epitopes for the MHC molecules with the MHC IC50 (nM) worth. Small values are associated with far better binders. A worth of 500 nM is often utilized as the threshold amongst bind.&lt;/div&gt;</summary>
		<author><name>Lyric14mimosa</name></author>	</entry>

	</feed>