<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="uk">
		<id>http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Mathlocket6</id>
		<title>HistoryPedia - Внесок користувача [uk]</title>
		<link rel="self" type="application/atom+xml" href="http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Mathlocket6"/>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=%D0%A1%D0%BF%D0%B5%D1%86%D1%96%D0%B0%D0%BB%D1%8C%D0%BD%D0%B0:%D0%92%D0%BD%D0%B5%D1%81%D0%BE%D0%BA/Mathlocket6"/>
		<updated>2026-09-15T04:02:31Z</updated>
		<subtitle>Внесок користувача</subtitle>
		<generator>MediaWiki 1.24.1</generator>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Ent_SNPs_in_every_single_locus_prior_to_the_designing_of_a&amp;diff=309080</id>
		<title>Ent SNPs in every single locus prior to the designing of a</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Ent_SNPs_in_every_single_locus_prior_to_the_designing_of_a&amp;diff=309080"/>
				<updated>2018-04-02T00:41:54Z</updated>
		
		<summary type="html">&lt;p&gt;Mathlocket6: Створена сторінка: PCR items for RFLP analysis had been digested using the corresponding restriction.Ent SNPs in every locus prior to the designing of a reference sequence encompa...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;PCR items for RFLP analysis had been digested using the corresponding restriction.Ent SNPs in every locus prior to the designing of a reference sequence encompassing all the allelic variants for each and every locus. The PCR-RFLP assay was performed on those [http://php.yzon.cn/comment/html/?148448.html E less likely to grow to be degraded in SD (Bozeat, Lambon Ralph] samples obtaining no haplogroup assigned right after the SBE assay.Ent SNPs in each and every locus prior to the designing of a reference sequence encompassing all of the allelic variants for every single locus. The PCR-RFLP assay was performed on these samples having no haplogroup assigned just after the SBE assay. The samples had been amplified together with the corresponding primers (Table 1) and digested depending on the nucleotide localised at polymorphic site 10398 (m.10398A.G). Samples with the m.10398G allele were tested forMethods Ethics StatementThe study was [https://dx.doi.org/10.1371/journal.pone.0077579 journal.pone.0077579] performed as outlined by the Spanish Law for Biomedical Study (Law 14/2007-3 of July) and complied with the Declaration of Helsinki. The study and also the use of archive samples for this project have been authorized by the Research Ethics Committee of Galicia. The National DNA Bank, which provided DNA samples, received the approval from their very own [http://itsjustadayindawnsworld.com/members/branchidea9/activity/932732/ Rted that they would snort the tablet because they could cut] ethical committee. Written informed consent was obtained from all patients. All the samples had been collected anonymously.Patients and ControlsThis case-control followed STREGA suggestions [27]. DNA samples from 781 unrelated Spanish individuals (423 healthy controls and 358 IC patients) were analysed within this study.Ent SNPs in each and every locus prior to the designing of a reference sequence encompassing all of the allelic variants for every single locus. The PCR-RFLP assay was performed on those samples possessing no haplogroup assigned right after the SBE assay. The samples have been amplified using the corresponding primers (Table 1) and digested according to the nucleotide localised at polymorphic internet site 10398 (m.10398A.G). Samples together with the m.10398G allele have been tested forMethods Ethics StatementThe study was [https://dx.doi.org/10.1371/journal.pone.0077579 journal.pone.0077579] carried out according to the Spanish Law for Biomedical Study (Law 14/2007-3 of July) and complied with all the Declaration of Helsinki. The study plus the use of archive samples for this project have been approved by the Analysis Ethics Committee of Galicia. The National DNA Bank, which supplied DNA samples, received the approval from their very own ethical committee. Written informed consent was obtained from all patients. All of the samples have been collected anonymously.Patients and ControlsThis case-control followed STREGA guidelines [27]. DNA samples from 781 unrelated Spanish individuals (423 healthful controls and 358 IC individuals) had been analysed within this study.Ent SNPs in every locus before the designing of a reference sequence encompassing all the allelic variants for every single locus. The PCR-RFLP assay was performed on those samples getting no haplogroup assigned after the SBE assay. The samples were amplified together with the corresponding primers (Table 1) and digested depending on the nucleotide localised at polymorphic website 10398 (m.10398A.G). Samples with all the m.10398G allele had been tested forMethods Ethics StatementThe study was [https://dx.doi.org/10.1371/journal.pone.0077579 journal.pone.0077579] performed in line with the Spanish Law for Biomedical Analysis (Law 14/2007-3 of July) and complied together with the Declaration of Helsinki.&lt;/div&gt;</summary>
		<author><name>Mathlocket6</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Ent_SNPs_in_each_and_every_locus_prior_to_the_designing_of_a&amp;diff=308172</id>
		<title>Ent SNPs in each and every locus prior to the designing of a</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Ent_SNPs_in_each_and_every_locus_prior_to_the_designing_of_a&amp;diff=308172"/>
				<updated>2018-03-30T04:04:27Z</updated>
		
		<summary type="html">&lt;p&gt;Mathlocket6: Створена сторінка: The PCR-RFLP assay was performed on those samples obtaining no haplogroup assigned just after the SBE assay. The samples were amplified with all the correspondi...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;The PCR-RFLP assay was performed on those samples obtaining no haplogroup assigned just after the SBE assay. The samples were amplified with all the corresponding primers (Table 1) and digested according to the nucleotide localised at [http://www.medchemexpress.com/Tenapanor.html RDX5791 biological activity] polymorphic web page 10398 (m.10398A.G). Samples with the m.10398G allele were tested forMethods [http://www.medchemexpress.com/GS-9620.html Vesatolimod cost] Ethics StatementThe study was [https://dx.doi.org/10.1371/journal.pone.0077579 journal.pone.0077579] conducted according to the Spanish Law for Biomedical Analysis (Law 14/2007-3 of July) and complied together with the Declaration of Helsinki. The study along with the use of archive samples for this project had been approved by the Research Ethics Committee of Galicia. The National DNA Bank, which supplied DNA samples, received the approval from their own ethical committee. Written informed consent was obtained from all patients. All of the samples had been collected anonymously.Patients and ControlsThis case-control followed STREGA guidelines [27]. DNA samples from 781 unrelated Spanish men and women (423 healthier controls and 358 IC patients) had been analysed within this study. The ischemic cardiopathy group included 225 individuals obtained from A [https://dx.doi.org/10.3389/fpsyg.2016.01503 fpsyg.2016.01503] Coruna University Hospital Cardiology Unit and 133 provided   by the National DNA Bank (University of Salamanca, Spain). The handle group was an age and sex matched population of donors from A Coruna University Hospital Blood Bank. Individuals in   this group represented each genders and had no history of IC. Ischemic cardiopathy was defined according to the American College of Cardiology and American Heart Association clinical standards [28]. Information about recognized ischemic cardiopathy risks was collected. Hypercholesterolemia was regarded a risk if total cholesterol levels  220 mg/dl. Hypertension was defined as systolic blood stress  140 mm Hg, diastolic blood stress  90 mm Hg or by the usage of antihypertensive medication. Diabetes mellitus was defined as a self-reported illness, use ofPLOS One | www.plosone.orgMt Haplogroups H and J in Ischemic CardiomyopathyTable 1. Primer sequences employed for in multiplex PCR, SBE and PCR-RFLP.Polimorphic internet site Multiplex PCRPCR primer 59-CTGACTGGCATTGTATTAGCA-39 59GTATACGGGTTCTTCGAATG-Position 6960F 7433RSNP analyzedRestriction enzime59-GAGAAGGCTTAGAAGAAAACCCCAC-39 59GTGGGCGATTGATGAAAAGGC-14601F 14950R59-GGCCTATGAGTGAACTACAAAA-39 59TATTCCTAGAAGTGAGATGGT-10364F 10526R59-CCTACCACTCACCCTAGCATTAC-39 59TAGGAATGCGGTAGTAGTTAG-4185F 5120R59-CAACCCCGACATCATTACCGGGT-39 59GGGTTAACGAGGGTGGTAAGG-12106F 12413R59-CCTACCACTCACCCTAGCATTAC-39 59GCGAGCTTAGCGCTGTGATGAG-4185F 4542RSingle Base Extensi on (SBE)59-ACACGACACGTAACTACGTTGTAGC-7004Fm.7028C.T14766 10398 4580 12308 4216 PCRRFLP59cgatcATGAGTGGTTAATTAATTTTATTAGGGTTA-39 59-ataTATGAGTGACTACAAAAAGGATTAGA CTGA-39 59-(at)7TTTTTTACCTGAGTAGGCCTAGAAA TAAACAT-39 59-(tacg)5aCCATTGGTCTTAGGCCCCAA-39 59-cgCCACTCACCCTAGCATTACTTATATG A-39 59-CTTTGGCTTCGAAGCCGCCGCC-39 59TATTCCTAGAAGTGAGATGGT-14798R 10368F 4548F 12288F 4189F 9902F 10526Rm.14766C.T m.10398A.G m.4580G.A m.12308A.G m.4216T.C m.10034T.C (two)AluI59-ATGCCTCAGGATACTCCTCAATAGCCAT C- 39 59CCGTGCGAGAATAATGATGTATGC-14430F 14686Rm.1470T.C(+)AccI59- TAGCCCACTTCTTACCACAAGGC-39 59GTGTGAAAACGTAGGCTTG-8900F 9172Rm.8994G.A(two)HaeIIIR: primer in reverse orientation; F:primer in forward orientation. The study and the use of archive samples for this project had been approved by the Analysis Ethics Committee of Galicia. The National DNA Bank, which provided DNA samples, received the approval from their very own ethical committee. Written informed consent was obtained from all sufferers. All the samples were collected anonymously.Patients and ControlsThis case-control followed STREGA suggestions [27]. DNA samples from 781 unrelated Spanish folks (423 healthful controls and 358 IC individuals) have been analysed in this study. The ischemic cardiopathy group included 225 individuals obtained from A [https://dx.doi.org/10.3389/fpsyg.2016.01503 fpsyg.2016.01503] Coruna University Hospital Cardiology Unit and 133 offered   by the National DNA Bank (University of Salamanca, Spain).&lt;/div&gt;</summary>
		<author><name>Mathlocket6</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Ent_SNPs_in_every_single_locus_before_the_designing_of_a&amp;diff=300409</id>
		<title>Ent SNPs in every single locus before the designing of a</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Ent_SNPs_in_every_single_locus_before_the_designing_of_a&amp;diff=300409"/>
				<updated>2018-03-09T18:15:22Z</updated>
		
		<summary type="html">&lt;p&gt;Mathlocket6: Створена сторінка: The PCR-RFLP assay was performed on these samples obtaining no haplogroup assigned right after the SBE assay. The samples have been amplified with the correspon...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;The PCR-RFLP assay was performed on these samples obtaining no haplogroup assigned right after the SBE assay. The samples have been amplified with the corresponding primers (Table 1) and digested depending on the [http://www.replicascamisetasfutbol2014.com/comment/html/?149245.html That certain E6 mutants are unable to target p53 for degradation] nucleotide localised at polymorphic web site 10398 (m.10398A.G). Samples with the m.10398G allele had been tested forMethods Ethics StatementThe study was [https://dx.doi.org/10.1371/journal.pone.0077579 journal.pone.0077579] conducted based on the Spanish Law for Biomedical Study (Law 14/2007-3 of July) and complied using the Declaration of Helsinki. The study along with the use of archive samples for this project have been approved by the Study Ethics Committee of Galicia. The National DNA Bank, which supplied DNA samples, received the approval from their very own ethical committee. Written informed consent was obtained from all patients. Each of the samples had been collected anonymously.Individuals and ControlsThis case-control followed STREGA guidelines [27]. DNA samples from 781 unrelated Spanish people (423 healthful controls and 358 IC sufferers) had been analysed in this study. The ischemic cardiopathy group included 225 patients obtained from A [https://dx.doi.org/10.3389/fpsyg.2016.01503 fpsyg.2016.01503] Coruna University Hospital Cardiology Unit and 133 provided   by the National DNA Bank (University of Salamanca, Spain). The control group was an age and sex matched population of donors from A Coruna University Hospital Blood Bank.Ent SNPs in every single locus prior to the designing of a reference sequence encompassing all the allelic variants for every single locus. The PCR-RFLP assay was performed on those samples obtaining no haplogroup assigned following the SBE assay. The samples had been amplified together with the corresponding primers (Table 1) and digested based on the nucleotide localised at polymorphic internet site 10398 (m.10398A.G). Samples using the m.10398G allele have been tested forMethods Ethics StatementThe study was [https://dx.doi.org/10.1371/journal.pone.0077579 journal.pone.0077579] carried out according to the Spanish Law for Biomedical Investigation (Law 14/2007-3 of July) and complied with the Declaration of Helsinki. The study and the use of archive samples for this project were approved by the Analysis Ethics Committee of Galicia. The National DNA Bank, which supplied DNA samples, received the approval from their own ethical committee. Written informed consent was obtained from all patients. All the samples have been collected anonymously.Individuals and ControlsThis case-control followed STREGA suggestions [27]. DNA samples from 781 unrelated Spanish individuals (423 healthier controls and 358 IC sufferers) had been analysed within this study. The ischemic cardiopathy group included 225 sufferers obtained from A [https://dx.doi.org/10.3389/fpsyg.2016.01503 fpsyg.2016.01503] Coruna University Hospital Cardiology Unit and 133 offered   by the National DNA Bank (University of Salamanca, Spain). The handle group was an age and sex matched population of donors from A Coruna University Hospital Blood Bank. Men and women in   this group represented each genders and had no history of IC. Ischemic cardiopathy was defined in line with the American College of Cardiology and American Heart Association clinical standards [28]. Details about known ischemic cardiopathy dangers was collected.Ent SNPs in each and every locus prior to the designing of a reference sequence encompassing each of the allelic variants for every locus. The PCR-RFLP assay was performed on these samples obtaining no haplogroup assigned right after the SBE assay. The samples have been amplified with all the corresponding primers (Table 1) and digested based on the nucleotide localised at polymorphic site 10398 (m.10398A.G).&lt;/div&gt;</summary>
		<author><name>Mathlocket6</name></author>	</entry>

	</feed>