<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="uk">
		<id>http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Shoe91stitch</id>
		<title>HistoryPedia - Внесок користувача [uk]</title>
		<link rel="self" type="application/atom+xml" href="http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Shoe91stitch"/>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=%D0%A1%D0%BF%D0%B5%D1%86%D1%96%D0%B0%D0%BB%D1%8C%D0%BD%D0%B0:%D0%92%D0%BD%D0%B5%D1%81%D0%BE%D0%BA/Shoe91stitch"/>
		<updated>2026-07-06T19:19:17Z</updated>
		<subtitle>Внесок користувача</subtitle>
		<generator>MediaWiki 1.24.1</generator>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=G_exons,_rRNA,_tRNA,_snoRNA,_snRNA,_and_identified_miRNAs,_we_pooled&amp;diff=277842</id>
		<title>G exons, rRNA, tRNA, snoRNA, snRNA, and identified miRNAs, we pooled</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=G_exons,_rRNA,_tRNA,_snoRNA,_snRNA,_and_identified_miRNAs,_we_pooled&amp;diff=277842"/>
				<updated>2018-01-18T07:29:28Z</updated>
		
		<summary type="html">&lt;p&gt;Shoe91stitch: Створена сторінка: We also identified three prospective novel miRNAs regarded as to become [http://www.heb-hjjp.com/comment/html/?.html Ding.Read length 700 700 2x150 2x150 2xRead...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;We also identified three prospective novel miRNAs regarded as to become [http://www.heb-hjjp.com/comment/html/?.html Ding.Read length 700 700 2x150 2x150 2xRead sum 140 M 120 M 7950 M 7950 M] drought-response miRNAs according to the differential expression amongst the CL and DT libraries. The results showed that the fold adjust of expression obtained by qRT-PCR was not fully consistent with bioinformatics analysis outcomes, however the expression trend was comparable (Fig. 4). The stem-loop secondary structure of four novel miRNAs is shown in Fig. five. These results suggested that Solexa sequencing was effectively applied to determine drought-related miRNAs in foxtail millet.Table 3 Prospective novel miRNAs with miRNA* located in S. italicamiRNA sit_novel_miR10 sit_novel_miR15 sit_novel_miR30 sit_novel_miR41 sit_novel_miR42 sit_novel_miR45 sit_novel_miR48 sit_novel_miR56 Mature Sequence GTATGGAAGAACTGCTGCGCCA CACTATAGGAGCTGGCCAGGT TTAGGCTCGGGGACTATGGTG GTGCTCCCTCCCGTTGTCACC TGAGCCGAACCAATATCACTC GGATATTGGTGCGGTTCAATC TGGTAGGCATTCTGGTTAAGT TTGACAGAAGAGAG.G exons, rRNA, tRNA, snoRNA, snRNA, and recognized miRNAs, we pooled the remaining unannotated sRNA sequences of two libraries and predicted novel miRNAs using miRcat application with default plant parameters and psRobot software. A total of 72 novelTo recognize drought-associated miRNAs of foxtail millet, we removed miRNAs whose expression levels were also low to be analyzed for differential expression (sequencing frequency [https://dx.doi.org/10.1037/a0022827 title= a0022827] DT libraries) and compared the normalized expression of miRNAs in between the CL and DT libraries. A total of 18 recognized miRNAs belonging to 16 families have been considerably expressed with extra than a single log2 fold modify (Extra file six). Among these DE miRNAs, 14 miRNAs (sit-miR1432-3p, sit-miR156a-5p, sit-miR156b-5p, sit-miR164a-5p, sit-miR167b-5p, sit-miR 171c-3p, sit-miR2118-3p, sit-miR390-5p, sit-miR394-5p, sit-miR395-3p, sit-miR408-3p, sit-miR529a-3p, sit-miR 529b-3p, and sit-miR827) were upregulated and four miRNAs (sit-miR159b-3p, sit-miR319c-5p, sit-miR528-5p and sit-miR535-5p) have been downregulated; a few of these miRNA families have been linked with droughtTable 2 Statistical evaluation of sRNAs for control (CL) and drought-treatment (DT) librariesCL (manage) Type Exon antisense Exon sense Intron antisense Intron sense miRNA rRNA repeat tRNA other people Total Uniq sRNAs 137 394 34 225 8698 98782 10278 7782 1361528 1487858 Percent 0.01 0.03 0.00 0.02 0.58 6.64 0.69 0.52 91.51 one hundred.00 Total sRNA 141 491 35 252 117589 2310754 184428 217892 11292502 14124084 Percent 0.00 0.00 0.00 0.00 0.83 16.36 [https://dx.doi.org/10.1038/srep18714 title= srep18714] 1.31 1.54 79.95 100.00 DT (drought-treatment) Uniq sRNAs 94 180 29 91 7814 118155 10425 9434 1433632 1579854 Percent 0.01 0.01 0.00 0.01 0.49 7.48 0.66 0.60 90.74 one hundred.00 Total sRNA 95 191 29 93 104080 2026243 197797 152753 7893561 10374842 % 0.00 0.00 0.00 0.00 1.00 19.53 1.91 1.47 76.08 one hundred.Wang et al. BMC Genetics (2016) 17:Page six ofTarget prediction of miRNAs and validation by degradome sequencingFig. three Expression levels of identified miRNA families in CL and DT librariesstress in previous studies: miR156 [31, 61], miR159 [23], miR167 [23, 61], miR395 [62], and miR408 [63]. We also identified 3 prospective novel miRNAs considered to be drought-response miRNAs based on the differential expression amongst the CL and DT libraries. Of these miRNAs, two (sit-novel-miR10, sit-novelmiR56) had been upregulated, and one particular (sit-novel-miR18) was downregulated (Additional file 7).&lt;/div&gt;</summary>
		<author><name>Shoe91stitch</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=G_exons,_rRNA,_tRNA,_snoRNA,_snRNA,_and_recognized_miRNAs,_we_pooled&amp;diff=277820</id>
		<title>G exons, rRNA, tRNA, snoRNA, snRNA, and recognized miRNAs, we pooled</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=G_exons,_rRNA,_tRNA,_snoRNA,_snRNA,_and_recognized_miRNAs,_we_pooled&amp;diff=277820"/>
				<updated>2018-01-18T06:16:35Z</updated>
		
		<summary type="html">&lt;p&gt;Shoe91stitch: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;G exons, rRNA, tRNA, snoRNA, snRNA, and recognized miRNAs, we pooled the remaining unannotated sRNA sequences of two libraries and predicted novel miRNAs working with [http://www.medchemexpress.com/MK-571-sodium-salt.html purchase L-660711 sodium salt] miRcat application with default plant parameters and psRobot application. To confirm the outcomes of miRNA sequencing and bioinformatics analysis, six identified miRNAs (sit-miR159b, sit-miR167b, sit-miR390, sit-miR394, sit-miR396a, and miR408) and 4 novel miRNAs (sit-novel-miR15, sitnovel-miR18, sit-novel-miR53, and sit-novel-miR56) were chosen randomly for validation by qRT-PCR. The results showed that the fold alter of expression obtained by qRT-PCR was not completely consistent with bioinformatics evaluation final results, but the expression trend was similar (Fig. 4). The stem-loop secondary structure of 4 novel miRNAs is shown in Fig. 5. These benefits suggested that Solexa sequencing was effectively applied to identify drought-related miRNAs in foxtail millet.Table 3 Possible novel miRNAs with miRNA* discovered in S.G exons, rRNA, tRNA, snoRNA, snRNA, and known miRNAs, we pooled the remaining unannotated sRNA sequences of two libraries and predicted novel miRNAs applying miRcat software program with default plant parameters and psRobot software. A total of 72 novelTo determine drought-associated miRNAs of foxtail millet, we removed miRNAs whose expression levels were as well low to become analyzed for differential expression (sequencing frequency [https://dx.doi.org/10.1037/a0022827 title= a0022827] DT libraries) and compared the normalized expression of miRNAs among the CL and DT libraries. A total of 18 identified miRNAs belonging to 16 households were substantially expressed with far more than one particular log2 fold transform (More file 6). Amongst these DE miRNAs, 14 miRNAs (sit-miR1432-3p, sit-miR156a-5p, sit-miR156b-5p, sit-miR164a-5p, sit-miR167b-5p, sit-miR 171c-3p, sit-miR2118-3p, sit-miR390-5p, sit-miR394-5p, sit-miR395-3p, sit-miR408-3p, sit-miR529a-3p, sit-miR 529b-3p, and sit-miR827) were upregulated and 4 miRNAs (sit-miR159b-3p, sit-miR319c-5p, sit-miR528-5p and sit-miR535-5p) have been downregulated; a number of these miRNA households have been related with droughtTable 2 Statistical analysis of sRNAs for manage (CL) and drought-treatment (DT) librariesCL (control) Form Exon antisense Exon sense Intron antisense Intron sense miRNA rRNA repeat tRNA others Total Uniq sRNAs 137 394 34 225 8698 98782 10278 7782 1361528 1487858 % 0.01 0.03 0.00 0.02 0.58 six.64 0.69 0.52 91.51 one hundred.00 Total sRNA 141 491 35 252 117589 2310754 184428 217892 11292502 14124084 Percent 0.00 0.00 0.00 0.00 0.83 16.36 [https://dx.doi.org/10.1038/srep18714 title= srep18714] 1.31 1.54 79.95 100.00 DT (drought-treatment) Uniq sRNAs 94 180 29 91 7814 118155 10425 9434 1433632 1579854 Percent 0.01 0.01 0.00 0.01 0.49 7.48 0.66 0.60 90.74 100.00 Total sRNA 95 191 29 93 104080 2026243 197797 152753 7893561 10374842 % 0.00 0.00 0.00 0.00 1.00 19.53 1.91 1.47 76.08 one hundred.Wang et al. BMC Genetics (2016) 17:Web page six ofTarget prediction of miRNAs and validation by degradome sequencingFig. 3 Expression levels of known miRNA households in CL and DT librariesstress in previous studies: miR156 [31, 61], miR159 [23], miR167 [23, 61], miR395 [62], and miR408 [63]. We also identified 3 prospective novel miRNAs considered to be drought-response miRNAs based on the differential expression involving the CL and DT libraries.&lt;/div&gt;</summary>
		<author><name>Shoe91stitch</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=G_exons,_rRNA,_tRNA,_snoRNA,_snRNA,_and_recognized_miRNAs,_we_pooled&amp;diff=277382</id>
		<title>G exons, rRNA, tRNA, snoRNA, snRNA, and recognized miRNAs, we pooled</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=G_exons,_rRNA,_tRNA,_snoRNA,_snRNA,_and_recognized_miRNAs,_we_pooled&amp;diff=277382"/>
				<updated>2018-01-17T07:30:39Z</updated>
		
		<summary type="html">&lt;p&gt;Shoe91stitch: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;To verify the results of miRNA sequencing and bioinformatics evaluation, six known miRNAs (sit-miR159b, [http://www.medchemexpress.com/RG7800.html RG7800 web] sit-miR167b, sit-miR390, sit-miR394, sit-miR396a, and miR408) and four novel miRNAs (sit-novel-miR15, sitnovel-miR18, sit-novel-miR53, and sit-novel-miR56) have been selected randomly for validation by qRT-PCR. A total of 72 novelTo determine drought-associated miRNAs of foxtail millet, we removed miRNAs whose expression levels had been also low to become analyzed for differential expression (sequencing frequency [https://dx.doi.org/10.1037/a0022827 title= a0022827] DT libraries) and compared the normalized expression of miRNAs between the CL and DT libraries. A total of 18 recognized miRNAs belonging to 16 families had been considerably expressed with extra than one log2 fold change (Added file six). Amongst these DE miRNAs, 14 miRNAs (sit-miR1432-3p, sit-miR156a-5p, sit-miR156b-5p, sit-miR164a-5p, sit-miR167b-5p, sit-miR 171c-3p, sit-miR2118-3p, sit-miR390-5p, sit-miR394-5p, sit-miR395-3p, sit-miR408-3p, sit-miR529a-3p, sit-miR 529b-3p, and sit-miR827) were upregulated and 4 miRNAs (sit-miR159b-3p, sit-miR319c-5p, sit-miR528-5p and sit-miR535-5p) had been downregulated; some of these miRNA households have been linked with droughtTable two Statistical analysis of sRNAs for control (CL) and drought-treatment (DT) librariesCL (manage) Kind Exon antisense Exon sense Intron antisense Intron sense miRNA rRNA repeat tRNA other people Total Uniq sRNAs 137 394 34 225 8698 98782 10278 7782 1361528 1487858 % 0.01 0.03 0.00 0.02 0.58 6.64 0.69 0.52 91.51 100.00 Total sRNA 141 491 35 252 117589 2310754 184428 217892 11292502 14124084 Percent 0.00 0.00 0.00 0.00 0.83 16.36 [https://dx.doi.org/10.1038/srep18714 title= srep18714] 1.31 1.54 79.95 one hundred.00 DT (drought-treatment) Uniq sRNAs 94 180 29 91 7814 118155 10425 9434 1433632 1579854 % 0.01 0.01 0.00 0.01 0.49 7.48 0.66 0.60 90.74 100.00 Total sRNA 95 191 29 93 104080 2026243 197797 152753 7893561 10374842 % 0.00 0.00 0.00 0.00 1.00 19.53 1.91 1.47 76.08 one hundred.Wang et al. BMC Genetics (2016) 17:Page six ofTarget prediction of miRNAs and validation by degradome sequencingFig. 3 Expression levels of identified miRNA families in CL and DT librariesstress in earlier studies: miR156 [31, 61], miR159 [23], miR167 [23, 61], miR395 [62], and miR408 [63]. We also identified three potential novel miRNAs regarded to be drought-response miRNAs depending on the differential expression among the CL and DT libraries. Of those miRNAs, two (sit-novel-miR10, sit-novelmiR56) have been upregulated, and a single (sit-novel-miR18) was downregulated (More file 7). To verify the outcomes of miRNA sequencing and bioinformatics evaluation, six identified miRNAs (sit-miR159b, sit-miR167b, sit-miR390, sit-miR394, sit-miR396a, and miR408) and 4 novel miRNAs (sit-novel-miR15, sitnovel-miR18, sit-novel-miR53, and sit-novel-miR56) were selected randomly for validation by qRT-PCR. The outcomes showed that the fold transform of expression obtained by qRT-PCR was not entirely constant with bioinformatics evaluation results, however the expression trend was equivalent (Fig. 4). The stem-loop secondary structure of four novel miRNAs is shown in Fig. 5.&lt;/div&gt;</summary>
		<author><name>Shoe91stitch</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=CGAGCAC_Arm_3p_5p_5p_3p_3p_5p_3p_5p_Length&amp;diff=276971</id>
		<title>CGAGCAC Arm 3p 5p 5p 3p 3p 5p 3p 5p Length</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=CGAGCAC_Arm_3p_5p_5p_3p_3p_5p_3p_5p_Length&amp;diff=276971"/>
				<updated>2018-01-16T06:24:50Z</updated>
		
		<summary type="html">&lt;p&gt;Shoe91stitch: Створена сторінка: Depending on the [http://geo.aster.net/members/tax31house/activity/279220/ Nt do current tips just scavenge new genetic information and deploy] abundance of deg...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Depending on the [http://geo.aster.net/members/tax31house/activity/279220/ Nt do current tips just scavenge new genetic information and deploy] abundance of degradome tags in the target websites, these cleaved targets have been classified into five categories; 42 target genes have been classified into category 0, four target genes into category 1, 6 target genes into category two, 2 target genes into category 3, and 2 target genes into category 4 (Table four). Of these 26 target genes, 10 had been in category two, 6 have been in category three, 4 have been in category four, 3 were in category 0 and 1. Descriptions on the target gene showed that the target genes of novel miRNAs had additional diverse functions, like hydroxyproline-rich glycoprotein, dirigent-like protein, ubiquitin conjugating enzyme protein, and a few unknown genes.CGAGCAC Arm 3p 5p 5p 3p 3p 5p 3p 5p Length (nt) 22 21 21 21 21 21 21In foxtail millet, many miRNA targets have been predicted previously [35, 36], but couple of miRNA targets have already been validated experimentally. To identify miRNA targets in foxtail millet at the worldwide level, we employed the degradome sequencing strategy to recognize target genes for recognized miRNAs and candidate novel miRNAs. Raw sequencing data generated by degradome sequencing are accessible at EMBL with the accession number ERP014368. After removing adapter sequences and lowquality tags, we obtained a total of 11,762,879 clean reads (3,528,168 distinctive reads) representing the 5' uncapped ends, of which 7,239,426 (two,433,599 unique reads) were perfectly matched to the S. italica genome. The reads that perfectly mapped to the genome had been subjected to further evaluation working with PAREsnip software program [52]. In this study, 56 target genes for 12 recognized miRNA families [https://dx.doi.org/10.1038/srep43317 title= srep43317] were identified. According to the abundance of degradome tags in the target websites, these cleaved targets were classified into five categories; 42 target genes were classified into category 0, four target genes into category 1, six target genes into category 2, two target genes into category three, and two target genes into category four (Table 4). The detailed data is supplied in Extra file 8, as well as the t-plots for targets are illustrated in Further file 9. The majority of identified miRNAs regulated a number of target genes (ranging from 1 to 11). Amongst them, the sit-miR156 household, with 11 one of a kind target genes, had the largest number of target genes; the sit-miR172 and sit-miR393 families had only one particular [https://dx.doi.org/10.1089/jir.2011.0073 title= jir.2011.0073] target gene, plus the others had two to eight targets. Functional analysis of these target genes showed that they have been enriched in transcription things, for example SBP-box transcription element (sit-miR156), MYB (sit-miR159), ARF (sit-miR160), NAC (sit-miR164), HD-zip transcription factor (sitmiR166), GRAS (sit-miR171), and GRF (sit-miR396). These outcomes were constant having a earlier study in S. italica along with other species [8, 35]. In addition, we identified a total of 26 target genes for 9 novel miRNAs (Extra file 8, Extra file ten).miRNA* sequence ATGGTGTACCGGTTGTTATGC AGGCTAGGCTTGCGACTGGAG CCGTAGCCCCTGCTCCTGATG TGACAACGAGAGAGAGCA CGTGGTGTTGTTTCGGCTCATG TTGAGCCGTGCCAATATCACG TTAGCCAAGAATGACTTGCCTATC GCTCGCTCCTCTTTCTGTCAGCpercursor location scaffold_7:35210708..35210784:scaffold_14:67096..67179:scaffold_5:4967704..4967886:scaffold_8:21627028..21627140:+ scaffold_1:34236041..34236153:+ scaffold_7:30396911..30397013:scaffold_3:6158117..6158229:+ scaffold_4:31435223..31435323:+MFE -30.2 -31.4 -101.four -71.two -53.1 -50.3 -49.two -66.Wang et al. BMC Genetics (2016) 17:Page 7 ofFig.&lt;/div&gt;</summary>
		<author><name>Shoe91stitch</name></author>	</entry>

	</feed>