<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="uk">
		<id>http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Sing40place</id>
		<title>HistoryPedia - Внесок користувача [uk]</title>
		<link rel="self" type="application/atom+xml" href="http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Sing40place"/>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=%D0%A1%D0%BF%D0%B5%D1%86%D1%96%D0%B0%D0%BB%D1%8C%D0%BD%D0%B0:%D0%92%D0%BD%D0%B5%D1%81%D0%BE%D0%BA/Sing40place"/>
		<updated>2026-07-06T19:19:17Z</updated>
		<subtitle>Внесок користувача</subtitle>
		<generator>MediaWiki 1.24.1</generator>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=CGAGCAC_Arm_3p_5p_5p_3p_3p_5p_3p_5p_Length&amp;diff=277552</id>
		<title>CGAGCAC Arm 3p 5p 5p 3p 3p 5p 3p 5p Length</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=CGAGCAC_Arm_3p_5p_5p_3p_3p_5p_3p_5p_Length&amp;diff=277552"/>
				<updated>2018-01-17T14:57:37Z</updated>
		
		<summary type="html">&lt;p&gt;Sing40place: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;The reads that perfectly mapped to the genome had been subjected to additional evaluation applying PAREsnip software program [52]. In this study, 56 target genes for 12 known miRNA families [https://dx.doi.org/10.1038/srep43317 title= srep43317] had been identified. Determined by the abundance of degradome tags in the target websites, these cleaved targets were classified into five categories; 42 target genes were classified into category 0, 4 target genes into category 1, six target genes into category 2, 2 target genes into category 3, and two target genes into category four (Table 4). The detailed information is provided in More file 8, and the [http://darkyblog.joorjoor.com/members/porch77tramp/activity/195815/ Www.biomedcentral.com/1472-6939/15/Page 7 ofOne would possibly anticipate conscientious objectors] t-plots for targets are illustrated in Further file 9. The majority of recognized miRNAs regulated numerous target genes (ranging from 1 to 11). Amongst them, the sit-miR156 family members, with 11 distinctive target genes, had the largest number of target genes; the sit-miR172 and sit-miR393 families had only one [https://dx.doi.org/10.1089/jir.2011.0073 title= jir.2011.0073] target gene, and the other folks had two to eight targets. Functional evaluation of these target genes showed that they had been enriched in transcription things, including SBP-box transcription issue (sit-miR156), MYB (sit-miR159), ARF (sit-miR160), NAC (sit-miR164), HD-zip transcription aspect (sitmiR166), GRAS (sit-miR171), and GRF (sit-miR396). These benefits were consistent with a previous study in S. italica and also other species [8, 35]. Moreover, we identified a total of 26 target genes for 9 novel miRNAs (Extra file eight, Further file ten).miRNA* sequence ATGGTGTACCGGTTGTTATGC AGGCTAGGCTTGCGACTGGAG CCGTAGCCCCTGCTCCTGATG TGACAACGAGAGAGAGCA CGTGGTGTTGTTTCGGCTCATG TTGAGCCGTGCCAATATCACG TTAGCCAAGAATGACTTGCCTATC GCTCGCTCCTCTTTCTGTCAGCpercursor place scaffold_7:35210708..35210784:scaffold_14:67096..67179:scaffold_5:4967704..4967886:scaffold_8:21627028..21627140:+ scaffold_1:34236041..34236153:+ scaffold_7:30396911..30397013:scaffold_3:6158117..6158229:+ scaffold_4:31435223..31435323:+MFE -30.two -31.four -101.4 -71.2 -53.1 -50.three -49.two -66.Wang et al. BMC Genetics (2016) 17:Web page 7 ofFig. 4 Differential expression evaluation of conserved and novel drought-responsive miRNAs. a Fold modify (log2) in handle library relative to drought library detected by solexa tiny RNA sequencing. b The relative expression degree of miRNAs measured by RT-qPCR. * suggests significant distinction among manage and drought anxiety at P  0.In contrast to the targets of recognized miRNAs, most targets of novel miRNAs fell into category 2. Of these 26 target genes, 10 have been in category 2, 6 were in category 3, four were in category four, three have been in category 0 and 1. Descriptions on the target gene showed that the target genes of novel miRNAs had far more diverse functions, such as hydroxyproline-rich glycoprotein, dirigent-like protein, ubiquitin conjugating enzyme protein, and a few unknown genes.CGAGCAC Arm 3p 5p 5p 3p 3p 5p 3p 5p Length (nt) 22 21 21 21 21 21 21In foxtail millet, numerous miRNA targets have already been predicted previously [35, 36], but few miRNA targets happen to be validated experimentally. To identify miRNA targets in foxtail millet at the worldwide level, we employed the degradome sequencing method to identify target genes for recognized miRNAs and candidate novel miRNAs. Raw sequencing information generated by degradome sequencing are available at EMBL with all the accession number ERP014368. Immediately after removing adapter sequences and lowquality tags, we obtained a total of 11,762,879 clean reads (three,528,168 special reads) representing the 5' uncapped ends, of which 7,239,426 (2,433,599 unique reads) have been perfectly matched to the S.&lt;/div&gt;</summary>
		<author><name>Sing40place</name></author>	</entry>

	</feed>