<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="uk">
		<id>http://istoriya.soippo.edu.ua/index.php?action=history&amp;feed=atom&amp;title=Jak_Eco</id>
		<title>Jak Eco - Історія редагувань</title>
		<link rel="self" type="application/atom+xml" href="http://istoriya.soippo.edu.ua/index.php?action=history&amp;feed=atom&amp;title=Jak_Eco"/>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Jak_Eco&amp;action=history"/>
		<updated>2026-04-15T21:52:34Z</updated>
		<subtitle>Історія редагувань цієї сторінки в вікі</subtitle>
		<generator>MediaWiki 1.24.1</generator>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Jak_Eco&amp;diff=208014&amp;oldid=prev</id>
		<title>Crayoncod49: Створена сторінка: N miRNA target sequence in to the 39-UTR of reporter genes and containing two independent expression cassettes encoding Gaussia luciferase (Gluc) and firefly lu...</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Jak_Eco&amp;diff=208014&amp;oldid=prev"/>
				<updated>2017-07-27T07:03:23Z</updated>
		
		<summary type="html">&lt;p&gt;Створена сторінка: N miRNA target sequence in to the 39-UTR of reporter genes and containing two independent expression cassettes encoding Gaussia luciferase (Gluc) and firefly lu...&lt;/p&gt;
&lt;p&gt;&lt;b&gt;Нова сторінка&lt;/b&gt;&lt;/p&gt;&lt;div&gt;N miRNA target sequence in to the 39-UTR of reporter genes and containing two independent expression cassettes encoding Gaussia luciferase (Gluc) and firefly luciferase (Fluc). Employing the Asensors, miRNA activity could be inferred by measuring the inhibition of reporter gene expression. Within this study, the real-time miRNA activity of miR-200a, -200b, -21, -96, -146a, -10a, -155, and -221 in 3 PDAC cell lines (BxPC-3, CFPAC-1, SW1990), 1 pancreatic epithelioid carcinoma (PANC-1), and human pancreatic nestin-expressing cells devoid of causing cancerassociated alterations (hTERT-HPNE) was monitored employing their corresponding Asensors. Most earlier study is consistent together with the results reflected by the Asensors, yet [http://www.medchemexpress.com/BD-AcAc-2.html Ketone Ester cost] Asensors offered new insights for some miRNAs, which might be significant for worldwide miRNA research.Monitoring of miRNAsPreliminary experiments showed that ten,000 cells infected by 108 copies of Asensors was the ideal ratio for monitoring miRNA activity in target cells and was applied within the following experiments. Cells had been seeded inside a 96-well cell culture plate (200 ml of advisable culture medium for each and every cell line) one day ahead of infection. After infection with the Asensors, the target cells were further incubated for three days, and on each and every day, 20 ml of supernatant was sampled to detect Gluc, and 20 ml of culture medium was refilled to keep 200 ml of total culture medium. On day 3, cells were lysed to quantify the Fluc internal handle.Assays of Fluc and Gluc ActivityThe Gluc and Fluc assay kits had been bought from New England Biolabs (Ipswich, MA, USA) and Promega (Madison, WI, USA), respectively. Cells in the 96-well plates have been spun down, in addition to a 20 ml aliquot in the cell-free medium in each and every nicely was taken for Gluc activity assays at 24, 48, and 72 hours. Substrate option (50 ml per properly) of Gluc was added in to the sample. For Fluc activity, 20 ml of cell lysate per properly was added for the substrate resolution (100 ml per effectively) of Fluc. Both Fluc and Gluc expression was then tested working with a luminometer (ModulusTM, Tuner BioSystems). The levels of Fluc and Gluc activity had been quantified working with relative light units (RLU).Components and Solutions miRNA Asensor ConstructionAll Asensors have been purchased from FivePlus Molecular Medicine Institute (Beijing, China). The miRNA Asensor array was established as previously reported [11]. The  miRNA Asensor plasmid was constructed determined by the AAV vector plasmid pAAV2neo and contained two independent expression cassettes encoding Fluc and Gluc [12]. The former was employed to calibrate the transduction efficiency, while the latter, which incorporated a miRNA great complementary target sequence in the 39-UTR of Gluc, was made use of to monitor miRNA activity. A synthetic poly(A) signal/ transcriptional pause web-site was inserted between the two expression cassettes and reduced the effects of spurious transcription around the Fluc reporter gene expression. miR-200a, -200b, -21, -96, -146a, 10a, -155, and -221 sensor plasmids have been constructed by inserting a single copy in the corresponding  miRNA target sequence, miR-200a (UAACACUGUCUGGUAACGAUGU), miR-200b (UAAUACUGCCUGGUAAUGAUGA), miR-21 (UAGCUUAUCAGACUGAUGUUGA), miR-96 (UUUGGCACUAGCACAUUUUUGCU), miR-146a (UGAGAACUGAAUUCCAUGGGUU), miR-10a (UACCCUGUAGAUCCGAAUUUGUG), miR-155 (UUAAUGCUAAUCGUGAUAGGGGU), or miR-221 (AGCUACAUUGUCUGCUGGGUUUC), in to the 39-UTR of Gluc.&lt;/div&gt;</summary>
		<author><name>Crayoncod49</name></author>	</entry>

	</feed>