<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="uk">
		<id>http://istoriya.soippo.edu.ua/index.php?action=history&amp;feed=atom&amp;title=Precisely_What_Is_Going_Down_With_Ribonucleotide_reductase</id>
		<title>Precisely What Is Going Down With Ribonucleotide reductase - Історія редагувань</title>
		<link rel="self" type="application/atom+xml" href="http://istoriya.soippo.edu.ua/index.php?action=history&amp;feed=atom&amp;title=Precisely_What_Is_Going_Down_With_Ribonucleotide_reductase"/>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Precisely_What_Is_Going_Down_With_Ribonucleotide_reductase&amp;action=history"/>
		<updated>2026-07-12T12:31:10Z</updated>
		<subtitle>Історія редагувань цієї сторінки в вікі</subtitle>
		<generator>MediaWiki 1.24.1</generator>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Precisely_What_Is_Going_Down_With_Ribonucleotide_reductase&amp;diff=187942&amp;oldid=prev</id>
		<title>Shirt65link: Створена сторінка: 50?��l of stimulus or control (phosphate buffered saline) was added to produce the concentrations shown: E.coli-derived LPS (10?ng/ml, 100?ng/ml; Sigma), Fl...</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Precisely_What_Is_Going_Down_With_Ribonucleotide_reductase&amp;diff=187942&amp;oldid=prev"/>
				<updated>2017-06-12T02:40:54Z</updated>
		
		<summary type="html">&lt;p&gt;Створена сторінка: 50?��l of stimulus or control (phosphate buffered saline) was added to produce the concentrations shown: E.coli-derived LPS (10?ng/ml, 100?ng/ml; Sigma), Fl...&lt;/p&gt;
&lt;p&gt;&lt;b&gt;Нова сторінка&lt;/b&gt;&lt;/p&gt;&lt;div&gt;50?��l of stimulus or control (phosphate buffered saline) was added to produce the concentrations shown: E.coli-derived LPS (10?ng/ml, 100?ng/ml; Sigma), Flagellin (5?��g/ml; Invivogen), Poly(I:C) (5?��g/ml; Invivogen), [http://www.selleckchem.com/products/ch5424802.html CH5424802 research buy] CpG DNA (5?��g/ml; Invivogen), Pam3Cys4 (10?��g/ml; Invivogen), TGF��1 (1.25?ng/ml; Peprotech), TGF��1-neutralising monoclonal antibody (1?��g/ml; Abcam). For experiments involving autologous neutrophils, 5?�� 105 were added either immediately following positive selection ( Lyons et?al., 2007) (nonapoptotic) or following induction of apoptosis (254?nm UV light [10?min] followed by 1?hr incubation; apoptotic). Average percentages of 7-AAD+, Annexin V+ neutrophils were 3% and 62% respectively, with?[http://en.wikipedia.org/wiki/Ribonucleotide_reductase Ribonucleotide reductase] by Meso Scale Discovery immunoassays for other cytokines (GMCSF, IL-1��, IL-2, IL-4, IL-5, IL-6, IL-8 and IL-12p70). All assessments were performed in triplicate. Stimulated monocytes (LPS, 100?ng/ml) were plated onto poly-L-lysine-coated coverslips at specific times, fixed (4% paraformaldehyde) and blocked (2% gelatin, 37��C, 1?hr). FOXO3 was stained using a primary antibody (Cell Signaling) and a secondary AF594-conjugated antibody (Molecular Signaling). Coverslips were mounted [http://www.selleckchem.com/products/VX-770.html VX 770] using Mowiol containing Hoechst dye. Images were captured (4 hpf per individual per time point) on a Zeiss LSM510 META Confocal Microscope and analyzed in a blinded fashion with Volocity software (Perkin Elmer). Cycloheximide was used at 5?��g/ml. Apoptosis was quantified following 24?hr stimulation (LPS, 100?ng/ml) by flow cytometry (7-AAD, Annexin V) and by quantification of mono- and oligonucleosomes in the cytoplasm and supernatants (Cell Death Detection ELISAPlus, Roche). ChIP-qPCR was performed using a commercial ChIP kit (Abcam) and aliquots of 3?�� 106 stimulated monocytes (LPS, 100?ng/ml, 12?hr). Chromatin was sheared by water-bath sonication (30?s cycles [on/off], 5?min; Bioruptor, Diagenode). FOXO3 was immunoprecipitated using a ChIP-grade antibody (Abcam). Positive (input) and negative (polyclonal IgG; BD Biosciences) controls were used. Quantitative PCR was performed for a region of the TGF��1 promoter predicted to contain a FOXO3-binding site (Forward, GCTTCTGTCCTTTCTAGG; Reverse, CAGCCTCCTGTCACTCAACA). 6 positive and 5 negative controls were used��all primers and genomic regions previously validated and published in Eijkelenboom et?al., 2013. Positive controls: PDGFRA-5 kb-DS-intron, HMGA-129 kb-DS-intron, KC6-210 kb-US, KLF6-37 kb-DS-intron, CYB5a-10 kb-DS-intron, MSTN-32 kb-US. Negative controls: Neg. control HBB, Neg. control GAPDH, Neg. control MB, Neg. control 1, Neg.&lt;/div&gt;</summary>
		<author><name>Shirt65link</name></author>	</entry>

	</feed>