Відмінності між версіями «Stories Provided by Fossariinae-Industry Professionals Who've Acheived Success»
(Створена сторінка: For determination of OVA-specific IgA, plates were coated overnight with 5?��g/ml OVA in sodium carbonate buffer. After blocking with 3% milk powder in PBS,...) |
(Немає відмінностей)
|
Поточна версія на 14:04, 4 червня 2017
For determination of OVA-specific IgA, plates were coated overnight with 5?��g/ml OVA in sodium carbonate buffer. After blocking with 3% milk powder in PBS, serial dilutions of sera were incubated overnight and detected with biotinylated goat anti-mouse IgA (Southern Biotech, Birmingham, AL, USA). The reaction was developed with streptavidin peroxidase and tetra methyl benzidine and stopped with sulphuric acid (all Sigma-Aldrich). The plates were Fossariinae measured at 450/690?nm and the amount of OVA-specific IgA was calculated according to the standard serum pool. Splenocytes were resuspended in RPMI 1640 medium supplemented with l-glutamine (2?mm), penicillin (100?U/ml), streptomycin (100?��g/ml) and 10% heat-inactivated fetal calf serum (all Biochrom/Seromed, Berlin, Germany). 106?cells/ml were either left in medium alone, stimulated with 250?��g/ml OVA and 5?��g/ml anti-CD28 (37.51; BD) for 96?h or with 20?ng/ml phorbol-12-myristate-13-acetate and 200?nm ionomycin for 48?h at 37��C, 5% CO2. Finally, IL-4, IL-10, IFN�� and TGF�� secretion was analysed in cell-free supernatants using ELISA according to manufacturer��s instructions (R&D Systems, Wiesbaden, Germany). Total RNA was extracted from frozen skin samples using RNA preparation kit from Macherey-Nagel (D��ren, Germany) and reversely transcribed into cDNA according to manufacturer��s guidelines (Applied Biosystem, Darmstadt, Germany). PCR amplification was performed with specific primers (IFN��: forward: AACTATTTTAACTCAAGTGGCATAGAT, reverse: TGCTGTTGCTGAAGAAGGTAG; IL-10: forward: TTTAAGGGTTACTTGGGTTGC, Selleck Sunitinib reverse: AGGGTCTTCAGCTTCTCACC; TGF��: forward: GCAACAACGCCATCTATGAG, reverse: AGACAGCCACTCAGGCGTAT). The relative selleck chemicals llc mRNA expression level was quantified based on the reference gene hypoxanthine phosphoribosyltransferase (HPRT; forward: CGTCGTGATTAGCGATGATG, reverse: AATCCAGCAGGTCAGCAAAG) by real-time quantitative RT-PCR using LightCycler 1.5 (Roche Diagnostics, Penzberg, Germany). As negative control, the template was replaced by sterile water. The melting curve analysis was used to control the melting point specificity. Efficiency corrected relative quantification was performed using 2?����CT method (21). Due to non-Gaussian distribution of the data, Mann�CWhitney-U-test test for non-parametrical, unpaired data was performed by using GraphPad Prism 5.0 (GraphPad Software Inc., La Jolla, CA, USA). A P-value