Відмінності між версіями «G exons, rRNA, tRNA, snoRNA, snRNA, and recognized miRNAs, we pooled»

Матеріал з HistoryPedia
Перейти до: навігація, пошук
м
м
 
(не показані 5 проміжних версій 4 учасників)
Рядок 1: Рядок 1:
−
G exons, rRNA, tRNA, snoRNA, snRNA, and recognized miRNAs, we pooled the remaining unannotated sRNA sequences of two libraries and predicted novel miRNAs working with [http://www.medchemexpress.com/MK-571-sodium-salt.html purchase L-660711 sodium salt] miRcat application with default plant parameters and psRobot application. To confirm the outcomes of miRNA sequencing and bioinformatics analysis, six identified miRNAs (sit-miR159b, sit-miR167b, sit-miR390, sit-miR394, sit-miR396a, and miR408) and 4 novel miRNAs (sit-novel-miR15, sitnovel-miR18, sit-novel-miR53, and sit-novel-miR56) were chosen randomly for validation by qRT-PCR. The results showed that the fold alter of expression obtained by qRT-PCR was not completely consistent with bioinformatics evaluation final results, but the expression trend was similar (Fig. 4). The stem-loop secondary structure of 4 novel miRNAs is shown in Fig. 5. These benefits suggested that Solexa sequencing was effectively applied to identify drought-related miRNAs in foxtail millet.Table 3 Possible novel miRNAs with miRNA* discovered in S.G exons, rRNA, tRNA, snoRNA, snRNA, and known miRNAs, we pooled the remaining unannotated sRNA sequences of two libraries and predicted novel miRNAs applying miRcat software program with default plant parameters and psRobot software. A total of 72 novelTo determine drought-associated miRNAs of foxtail millet, we removed miRNAs whose expression levels were as well low to become analyzed for differential expression (sequencing frequency [https://dx.doi.org/10.1037/a0022827 title= a0022827] DT libraries) and compared the normalized expression of miRNAs among the CL and DT libraries. A total of 18 identified miRNAs belonging to 16 households were substantially expressed with far more than one particular log2 fold transform (More file 6). Amongst these DE miRNAs, 14 miRNAs (sit-miR1432-3p, sit-miR156a-5p, sit-miR156b-5p, sit-miR164a-5p, sit-miR167b-5p, sit-miR 171c-3p, sit-miR2118-3p, sit-miR390-5p, sit-miR394-5p, sit-miR395-3p, sit-miR408-3p, sit-miR529a-3p, sit-miR 529b-3p, and sit-miR827) were upregulated and 4 miRNAs (sit-miR159b-3p, sit-miR319c-5p, sit-miR528-5p and sit-miR535-5p) have been downregulated; a number of these miRNA households have been related with droughtTable 2 Statistical analysis of sRNAs for manage (CL) and drought-treatment (DT) librariesCL (control) Form Exon antisense Exon sense Intron antisense Intron sense miRNA rRNA repeat tRNA others Total Uniq sRNAs 137 394 34 225 8698 98782 10278 7782 1361528 1487858 % 0.01 0.03 0.00 0.02 0.58 six.64 0.69 0.52 91.51 one hundred.00 Total sRNA 141 491 35 252 117589 2310754 184428 217892 11292502 14124084 Percent 0.00 0.00 0.00 0.00 0.83 16.36 [https://dx.doi.org/10.1038/srep18714 title= srep18714] 1.31 1.54 79.95 100.00 DT (drought-treatment) Uniq sRNAs 94 180 29 91 7814 118155 10425 9434 1433632 1579854 Percent 0.01 0.01 0.00 0.01 0.49 7.48 0.66 0.60 90.74 100.00 Total sRNA 95 191 29 93 104080 2026243 197797 152753 7893561 10374842 % 0.00 0.00 0.00 0.00 1.00 19.53 1.91 1.47 76.08 one hundred.Wang et al. BMC Genetics (2016) 17:Web page six ofTarget prediction of miRNAs and validation by degradome sequencingFig. 3 Expression levels of known miRNA households in CL and DT librariesstress in previous studies: miR156 [31, 61], miR159 [23], miR167 [23, 61], miR395 [62], and miR408 [63]. We also identified 3 prospective novel miRNAs considered to be drought-response miRNAs based on the differential expression involving the CL and DT libraries.
+
A total of 72 novelTo recognize drought-associated miRNAs of foxtail millet, we removed miRNAs whose expression levels have been also low to be analyzed for differential expression (sequencing frequency [https://dx.doi.org/10.1037/a0022827 title= a0022827] DT libraries) and compared the normalized expression of miRNAs amongst the CL and DT libraries. A total of 18 identified miRNAs belonging to 16 families were drastically expressed with additional than one log2 fold transform (Additional file six). Among these DE miRNAs, 14 miRNAs (sit-miR1432-3p, sit-miR156a-5p, sit-miR156b-5p, sit-miR164a-5p, sit-miR167b-5p, sit-miR 171c-3p, sit-miR2118-3p, sit-miR390-5p, sit-miR394-5p, sit-miR395-3p, sit-miR408-3p, sit-miR529a-3p, sit-miR 529b-3p, and sit-miR827) have been upregulated and 4 miRNAs (sit-miR159b-3p, sit-miR319c-5p, sit-miR528-5p and sit-miR535-5p) had been downregulated; some of these miRNA households have been associated with droughtTable two Statistical analysis of sRNAs for manage (CL) and drought-treatment (DT) librariesCL (control) Type Exon antisense Exon sense Intron antisense Intron sense miRNA rRNA repeat tRNA other folks Total Uniq sRNAs 137 394 34 225 8698 98782 10278 7782 1361528 1487858 % 0.01 0.03 0.00 0.02 0.58 6.64 0.69 0.52 91.51 100.00 Total sRNA 141 491 35 252 117589 2310754 184428 217892 11292502 14124084 % 0.00 0.00 0.00 0.00 0.83 16.36 [https://dx.doi.org/10.1038/srep18714 title= srep18714] 1.31 1.54 79.95 100.00 DT (drought-treatment) Uniq sRNAs 94 180 29 91 7814 118155 10425 9434 1433632 1579854 % 0.01 0.01 0.00 0.01 0.49 7.48 0.66 0.60 90.74 100.00 Total sRNA 95 191 29 93 104080 2026243 197797 152753 7893561 10374842 % 0.00 0.00 0.00 0.00 1.00 19.53 1.91 1.47 76.08 100.Wang et al. BMC Genetics (2016) 17:Page 6 ofTarget prediction of miRNAs and validation by degradome sequencingFig. three Expression levels of identified miRNA families in CL and DT librariesstress in previous research: miR156 [31, 61], miR159 [23], miR167 [23, 61], miR395 [62], and miR408 [63]. We also identified three possible novel miRNAs regarded to become drought-response miRNAs determined by the differential expression between the CL and DT libraries. Of these miRNAs, two (sit-novel-miR10, sit-novelmiR56) had been upregulated, and a single (sit-novel-miR18) was downregulated (Added file 7). To verify the outcomes of miRNA sequencing and bioinformatics analysis, six identified miRNAs (sit-miR159b, sit-miR167b, sit-miR390, sit-miR394, [http://besocietal.com/members/wrenchadvice9/activity/529518/ Ion and expression profiling of foxtail millet [Setaria italica (L.)] miRNAs] sit-miR396a, and miR408) and four novel miRNAs (sit-novel-miR15, sitnovel-miR18, sit-novel-miR53, and sit-novel-miR56) had been chosen randomly for validation by qRT-PCR. The outcomes showed that the fold adjust of expression obtained by qRT-PCR was not totally consistent with bioinformatics analysis outcomes, but the expression trend was similar (Fig. four). The stem-loop secondary structure of four novel miRNAs is shown in Fig. five. These results recommended that Solexa sequencing was successfully applied to identify drought-related miRNAs in foxtail millet.Table 3 Potential novel miRNAs with miRNA* identified in S. italicamiRNA sit_novel_miR10 sit_novel_miR15 sit_novel_miR30 sit_novel_miR41 sit_novel_miR42 sit_novel_miR45 sit_novel_miR48 sit_novel_miR56 Mature Sequence GTATGGAAGAACTGCTGCGCCA CACTATAGGAGCTGGCCAGGT TTAGGCTCGGGGACTATGGTG GTGCTCCCTCCCGTTGTCACC TGAGCCGAACCAATATCACTC GGATATTGGTGCGGTTCAATC TGGTAGGCATTCTGGTTAAGT TTGACAGAAGAGAG.

Поточна версія на 14:07, 9 лютого 2018

A total of 72 novelTo recognize drought-associated miRNAs of foxtail millet, we removed miRNAs whose expression levels have been also low to be analyzed for differential expression (sequencing frequency title= a0022827 DT libraries) and compared the normalized expression of miRNAs amongst the CL and DT libraries. A total of 18 identified miRNAs belonging to 16 families were drastically expressed with additional than one log2 fold transform (Additional file six). Among these DE miRNAs, 14 miRNAs (sit-miR1432-3p, sit-miR156a-5p, sit-miR156b-5p, sit-miR164a-5p, sit-miR167b-5p, sit-miR 171c-3p, sit-miR2118-3p, sit-miR390-5p, sit-miR394-5p, sit-miR395-3p, sit-miR408-3p, sit-miR529a-3p, sit-miR 529b-3p, and sit-miR827) have been upregulated and 4 miRNAs (sit-miR159b-3p, sit-miR319c-5p, sit-miR528-5p and sit-miR535-5p) had been downregulated; some of these miRNA households have been associated with droughtTable two Statistical analysis of sRNAs for manage (CL) and drought-treatment (DT) librariesCL (control) Type Exon antisense Exon sense Intron antisense Intron sense miRNA rRNA repeat tRNA other folks Total Uniq sRNAs 137 394 34 225 8698 98782 10278 7782 1361528 1487858 % 0.01 0.03 0.00 0.02 0.58 6.64 0.69 0.52 91.51 100.00 Total sRNA 141 491 35 252 117589 2310754 184428 217892 11292502 14124084 % 0.00 0.00 0.00 0.00 0.83 16.36 title= srep18714 1.31 1.54 79.95 100.00 DT (drought-treatment) Uniq sRNAs 94 180 29 91 7814 118155 10425 9434 1433632 1579854 % 0.01 0.01 0.00 0.01 0.49 7.48 0.66 0.60 90.74 100.00 Total sRNA 95 191 29 93 104080 2026243 197797 152753 7893561 10374842 % 0.00 0.00 0.00 0.00 1.00 19.53 1.91 1.47 76.08 100.Wang et al. BMC Genetics (2016) 17:Page 6 ofTarget prediction of miRNAs and validation by degradome sequencingFig. three Expression levels of identified miRNA families in CL and DT librariesstress in previous research: miR156 [31, 61], miR159 [23], miR167 [23, 61], miR395 [62], and miR408 [63]. We also identified three possible novel miRNAs regarded to become drought-response miRNAs determined by the differential expression between the CL and DT libraries. Of these miRNAs, two (sit-novel-miR10, sit-novelmiR56) had been upregulated, and a single (sit-novel-miR18) was downregulated (Added file 7). To verify the outcomes of miRNA sequencing and bioinformatics analysis, six identified miRNAs (sit-miR159b, sit-miR167b, sit-miR390, sit-miR394, Ion and expression profiling of foxtail millet [Setaria italica (L.) miRNAs] sit-miR396a, and miR408) and four novel miRNAs (sit-novel-miR15, sitnovel-miR18, sit-novel-miR53, and sit-novel-miR56) had been chosen randomly for validation by qRT-PCR. The outcomes showed that the fold adjust of expression obtained by qRT-PCR was not totally consistent with bioinformatics analysis outcomes, but the expression trend was similar (Fig. four). The stem-loop secondary structure of four novel miRNAs is shown in Fig. five. These results recommended that Solexa sequencing was successfully applied to identify drought-related miRNAs in foxtail millet.Table 3 Potential novel miRNAs with miRNA* identified in S. italicamiRNA sit_novel_miR10 sit_novel_miR15 sit_novel_miR30 sit_novel_miR41 sit_novel_miR42 sit_novel_miR45 sit_novel_miR48 sit_novel_miR56 Mature Sequence GTATGGAAGAACTGCTGCGCCA CACTATAGGAGCTGGCCAGGT TTAGGCTCGGGGACTATGGTG GTGCTCCCTCCCGTTGTCACC TGAGCCGAACCAATATCACTC GGATATTGGTGCGGTTCAATC TGGTAGGCATTCTGGTTAAGT TTGACAGAAGAGAG.

Отримано з http://istoriya.soippo.edu.ua/index.php?title=G_exons,_rRNA,_tRNA,_snoRNA,_snRNA,_and_recognized_miRNAs,_we_pooled&oldid=285953