Відмінності між версіями «G exons, rRNA, tRNA, snoRNA, snRNA, and recognized miRNAs, we pooled»

Матеріал з HistoryPedia
Перейти до: навігація, пошук
м
м
Рядок 1: Рядок 1:
−
A total of 72 novelTo identify drought-associated [http://05961.net/comment/html/?321430.html Volves functioning within a conflict zone that's specifically harmful for] miRNAs of foxtail millet, we removed miRNAs whose expression levels were also low to become analyzed for differential expression (sequencing frequency [https://dx.doi.org/10.1037/a0022827 title= a0022827] DT libraries) and compared the normalized expression of miRNAs between the CL and DT libraries. A total of 18 recognized miRNAs belonging to 16 households have been significantly expressed with more than one log2 fold transform (Extra file six). Amongst these DE miRNAs, 14 miRNAs (sit-miR1432-3p, sit-miR156a-5p, sit-miR156b-5p, sit-miR164a-5p, sit-miR167b-5p, sit-miR 171c-3p, sit-miR2118-3p, sit-miR390-5p, sit-miR394-5p, sit-miR395-3p, sit-miR408-3p, sit-miR529a-3p, sit-miR 529b-3p, and sit-miR827) had been upregulated and 4 miRNAs (sit-miR159b-3p, sit-miR319c-5p, sit-miR528-5p and sit-miR535-5p) have been downregulated; a few of these miRNA families have already been associated with droughtTable 2 Statistical analysis of sRNAs for control (CL) and drought-treatment (DT) librariesCL (handle) Form Exon antisense Exon sense Intron antisense Intron sense miRNA rRNA repeat tRNA other people Total Uniq sRNAs 137 394 34 225 8698 98782 10278 7782 1361528 1487858 % 0.01 0.03 0.00 0.02 0.58 six.64 0.69 0.52 91.51 100.00 Total sRNA 141 491 35 252 117589 2310754 184428 217892 11292502 14124084 % 0.00 0.00 0.00 0.00 0.83 16.36 [https://dx.doi.org/10.1038/srep18714 title= srep18714] 1.31 1.54 79.95 100.00 DT (drought-treatment) Uniq sRNAs 94 180 29 91 7814 118155 10425 9434 1433632 1579854 % 0.01 0.01 0.00 0.01 0.49 7.48 0.66 0.60 90.74 100.00 Total sRNA 95 191 29 93 104080 2026243 197797 152753 7893561 10374842 Percent 0.00 0.00 0.00 0.00 1.00 19.53 1.91 1.47 76.08 100.Wang et al. BMC Genetics (2016) 17:Page six ofTarget prediction of miRNAs and validation by degradome sequencingFig. 3 Expression levels of known miRNA households in CL and DT librariesstress in prior research: miR156 [31, 61], miR159 [23], miR167 [23, 61], miR395 [62], and miR408 [63]. We also identified 3 possible novel miRNAs thought of to be drought-response miRNAs based on the differential expression among the CL and DT libraries. Of those miRNAs, two (sit-novel-miR10, sit-novelmiR56) have been upregulated, and 1 (sit-novel-miR18) was downregulated (More file 7). To verify the outcomes of miRNA sequencing and bioinformatics analysis, six recognized miRNAs (sit-miR159b, sit-miR167b, sit-miR390, sit-miR394, [http://site.vhostgo.com/comment/html/?30036.html To refugees will do so. In this instance, the assumption is] sit-miR396a, and miR408) and 4 novel miRNAs (sit-novel-miR15, sitnovel-miR18, sit-novel-miR53, and sit-novel-miR56) were chosen randomly for validation by qRT-PCR. The results showed that the fold alter of expression obtained by qRT-PCR was not totally consistent with bioinformatics analysis results, but the expression trend was similar (Fig. four). The stem-loop secondary structure of four novel miRNAs is shown in Fig. five. These outcomes suggested that Solexa sequencing was successfully applied to identify drought-related miRNAs in foxtail millet.Table three Potential novel miRNAs with miRNA* located in S. italicamiRNA sit_novel_miR10 sit_novel_miR15 sit_novel_miR30 sit_novel_miR41 sit_novel_miR42 sit_novel_miR45 sit_novel_miR48 sit_novel_miR56 Mature Sequence GTATGGAAGAACTGCTGCGCCA CACTATAGGAGCTGGCCAGGT TTAGGCTCGGGGACTATGGTG GTGCTCCCTCCCGTTGTCACC TGAGCCGAACCAATATCACTC GGATATTGGTGCGGTTCAATC TGGTAGGCATTCTGGTTAAGT TTGACAGAAGAGAG.G exons, rRNA, tRNA, snoRNA, snRNA, and known miRNAs, we pooled the remaining unannotated sRNA sequences of two libraries and predicted novel miRNAs using miRcat software program with default plant parameters and psRobot software.
+
15. Park MY, Wu G, Gonzalez-Sulser A, Vaucheret H, Poethig RS. Nuclear sit-miR395-3p, sit-miR408-3p, sit-miR529a-3p, sit-miR 529b-3p, and sit-miR827) have been upregulated and 4 miRNAs (sit-miR159b-3p, sit-miR319c-5p, sit-miR528-5p and sit-miR535-5p) had been downregulated; a few of these miRNA households happen to be associated with droughtTable two Statistical evaluation of sRNAs for handle (CL) and drought-treatment (DT) librariesCL (handle) Form Exon antisense Exon sense Intron antisense Intron sense miRNA rRNA repeat tRNA other people Total Uniq sRNAs 137 394 34 225 8698 98782 10278 7782 1361528 1487858 % 0.01 0.03 0.00 0.02 0.58 6.64 0.69 0.52 91.51 one hundred.00 Total sRNA 141 491 35 252 117589 2310754 184428 217892 11292502 14124084 % 0.00 0.00 0.00 0.00 0.83 16.36 [https://dx.doi.org/10.1038/srep18714 title= srep18714] 1.31 1.54 79.95 100.00 DT (drought-treatment) Uniq sRNAs 94 180 29 91 7814 118155 10425 9434 1433632 1579854 Percent 0.01 0.01 0.00 0.01 0.49 7.48 0.66 0.60 90.74 one hundred.00 Total sRNA 95 191 29 93 104080 2026243 [http://ques2ans.gatentry.com/index.php?qa=137574&qa_1=data-analysis-participated-within-study-design-and-style-and Data evaluation. DZ and BL participated within the study design and] 197797 152753 7893561 10374842 % 0.00 0.00 0.00 0.00 1.00 19.53 1.91 1.47 76.08 one hundred.Wang et al. BMC Genetics (2016) 17:Web page 6 ofTarget prediction of miRNAs and validation by degradome sequencingFig. 3 Expression levels of identified miRNA households in CL and DT librariesstress in preceding research: miR156 [31, 61], miR159 [23], miR167 [23, 61], miR395 [62], and miR408 [63]. We also identified 3 prospective novel miRNAs regarded as to be drought-response miRNAs depending on the differential expression between the CL and DT libraries. Of these miRNAs, two (sit-novel-miR10, sit-novelmiR56) had been upregulated, and a single (sit-novel-miR18) was downregulated (Added file 7). To confirm the outcomes of miRNA sequencing and bioinformatics analysis, six recognized miRNAs (sit-miR159b, sit-miR167b, sit-miR390, sit-miR394, sit-miR396a, and miR408) and four novel miRNAs (sit-novel-miR15, sitnovel-miR18, sit-novel-miR53, and sit-novel-miR56) have been chosen randomly for validation by qRT-PCR. The outcomes showed that the fold change of expression obtained by qRT-PCR was not fully constant with bioinformatics evaluation benefits, however the expression trend was related (Fig. 4). The stem-loop secondary structure of four novel miRNAs is shown in Fig. five.G exons, rRNA, tRNA, snoRNA, snRNA, and identified miRNAs, we pooled the remaining unannotated sRNA sequences of two libraries and predicted novel miRNAs applying miRcat application with default plant parameters and psRobot software. A total of 72 novelTo recognize drought-associated miRNAs of foxtail millet, we removed miRNAs whose expression levels were also low to be analyzed for differential expression (sequencing frequency [https://dx.doi.org/10.1037/a0022827 title= a0022827] DT libraries) and compared the normalized expression of miRNAs in between the CL and DT libraries. A total of 18 known miRNAs belonging to 16 families have been significantly expressed with much more than one log2 fold alter (More file six). Among these DE miRNAs, 14 miRNAs (sit-miR1432-3p, sit-miR156a-5p, sit-miR156b-5p, sit-miR164a-5p, sit-miR167b-5p, sit-miR 171c-3p, sit-miR2118-3p, sit-miR390-5p, sit-miR394-5p, sit-miR395-3p, sit-miR408-3p, sit-miR529a-3p, sit-miR 529b-3p, and sit-miR827) had been upregulated and four miRNAs (sit-miR159b-3p, sit-miR319c-5p, sit-miR528-5p and sit-miR535-5p) were downregulated; a few of these miRNA households happen to be associated with droughtTable two Statistical evaluation of sRNAs for handle (CL) and drought-treatment (DT) librariesCL (control) Variety Exon antisense Exon sense Intron antisense Intron sense miRNA rRNA repeat tRNA other folks Total Uniq sRNAs 137 394 34 225 8698 98782 10278 7782 1361528 1487858 % 0.01 0.03 0.00 0.02 0.58 6.64 0.69 0.52 91.51 one hundred.00 Total sRNA 141 491 35 252 117589 2310754 184428 217892 11292502 14124084 % 0.00 0.00 0.00 0.00 0.83 16.36 [https://dx.doi.org/10.1038/srep18714 title= srep18714] 1.31 1.54 79.95 100.00 DT (drought-treatment) Uniq sRNAs 94 180 29 91 7814 118155 10425 9434 1433632 1579854 % 0.01 0.01 0.00 0.01 0.49 7.48 0.66 0.60 90.74 one hundred.00 Total sRNA 95 191 29 93 104080 2026243 197797 152753 7893561 10374842 % 0.00 0.00 0.00 0.00 1.00 19.53 1.91 1.47 76.08 100.Wang et al.

Версія за 11:21, 25 січня 2018

15. Park MY, Wu G, Gonzalez-Sulser A, Vaucheret H, Poethig RS. Nuclear sit-miR395-3p, sit-miR408-3p, sit-miR529a-3p, sit-miR 529b-3p, and sit-miR827) have been upregulated and 4 miRNAs (sit-miR159b-3p, sit-miR319c-5p, sit-miR528-5p and sit-miR535-5p) had been downregulated; a few of these miRNA households happen to be associated with droughtTable two Statistical evaluation of sRNAs for handle (CL) and drought-treatment (DT) librariesCL (handle) Form Exon antisense Exon sense Intron antisense Intron sense miRNA rRNA repeat tRNA other people Total Uniq sRNAs 137 394 34 225 8698 98782 10278 7782 1361528 1487858 % 0.01 0.03 0.00 0.02 0.58 6.64 0.69 0.52 91.51 one hundred.00 Total sRNA 141 491 35 252 117589 2310754 184428 217892 11292502 14124084 % 0.00 0.00 0.00 0.00 0.83 16.36 title= srep18714 1.31 1.54 79.95 100.00 DT (drought-treatment) Uniq sRNAs 94 180 29 91 7814 118155 10425 9434 1433632 1579854 Percent 0.01 0.01 0.00 0.01 0.49 7.48 0.66 0.60 90.74 one hundred.00 Total sRNA 95 191 29 93 104080 2026243 Data evaluation. DZ and BL participated within the study design and 197797 152753 7893561 10374842 % 0.00 0.00 0.00 0.00 1.00 19.53 1.91 1.47 76.08 one hundred.Wang et al. BMC Genetics (2016) 17:Web page 6 ofTarget prediction of miRNAs and validation by degradome sequencingFig. 3 Expression levels of identified miRNA households in CL and DT librariesstress in preceding research: miR156 [31, 61], miR159 [23], miR167 [23, 61], miR395 [62], and miR408 [63]. We also identified 3 prospective novel miRNAs regarded as to be drought-response miRNAs depending on the differential expression between the CL and DT libraries. Of these miRNAs, two (sit-novel-miR10, sit-novelmiR56) had been upregulated, and a single (sit-novel-miR18) was downregulated (Added file 7). To confirm the outcomes of miRNA sequencing and bioinformatics analysis, six recognized miRNAs (sit-miR159b, sit-miR167b, sit-miR390, sit-miR394, sit-miR396a, and miR408) and four novel miRNAs (sit-novel-miR15, sitnovel-miR18, sit-novel-miR53, and sit-novel-miR56) have been chosen randomly for validation by qRT-PCR. The outcomes showed that the fold change of expression obtained by qRT-PCR was not fully constant with bioinformatics evaluation benefits, however the expression trend was related (Fig. 4). The stem-loop secondary structure of four novel miRNAs is shown in Fig. five.G exons, rRNA, tRNA, snoRNA, snRNA, and identified miRNAs, we pooled the remaining unannotated sRNA sequences of two libraries and predicted novel miRNAs applying miRcat application with default plant parameters and psRobot software. A total of 72 novelTo recognize drought-associated miRNAs of foxtail millet, we removed miRNAs whose expression levels were also low to be analyzed for differential expression (sequencing frequency title= a0022827 DT libraries) and compared the normalized expression of miRNAs in between the CL and DT libraries. A total of 18 known miRNAs belonging to 16 families have been significantly expressed with much more than one log2 fold alter (More file six). Among these DE miRNAs, 14 miRNAs (sit-miR1432-3p, sit-miR156a-5p, sit-miR156b-5p, sit-miR164a-5p, sit-miR167b-5p, sit-miR 171c-3p, sit-miR2118-3p, sit-miR390-5p, sit-miR394-5p, sit-miR395-3p, sit-miR408-3p, sit-miR529a-3p, sit-miR 529b-3p, and sit-miR827) had been upregulated and four miRNAs (sit-miR159b-3p, sit-miR319c-5p, sit-miR528-5p and sit-miR535-5p) were downregulated; a few of these miRNA households happen to be associated with droughtTable two Statistical evaluation of sRNAs for handle (CL) and drought-treatment (DT) librariesCL (control) Variety Exon antisense Exon sense Intron antisense Intron sense miRNA rRNA repeat tRNA other folks Total Uniq sRNAs 137 394 34 225 8698 98782 10278 7782 1361528 1487858 % 0.01 0.03 0.00 0.02 0.58 6.64 0.69 0.52 91.51 one hundred.00 Total sRNA 141 491 35 252 117589 2310754 184428 217892 11292502 14124084 % 0.00 0.00 0.00 0.00 0.83 16.36 title= srep18714 1.31 1.54 79.95 100.00 DT (drought-treatment) Uniq sRNAs 94 180 29 91 7814 118155 10425 9434 1433632 1579854 % 0.01 0.01 0.00 0.01 0.49 7.48 0.66 0.60 90.74 one hundred.00 Total sRNA 95 191 29 93 104080 2026243 197797 152753 7893561 10374842 % 0.00 0.00 0.00 0.00 1.00 19.53 1.91 1.47 76.08 100.Wang et al.

Отримано з http://istoriya.soippo.edu.ua/index.php?title=G_exons,_rRNA,_tRNA,_snoRNA,_snRNA,_and_recognized_miRNAs,_we_pooled&oldid=280217