Відмінності між версіями «CGAGCAC Arm 3p 5p 5p 3p 3p 5p 3p 5p Length»
м |
м |
||
Рядок 1: | Рядок 1: | ||
− | + | CGAGCAC Arm 3p 5p 5p 3p 3p 5p 3p 5p Length (nt) 22 21 21 21 21 21 21In foxtail millet, numerous miRNA targets happen to be predicted previously [35, 36], but handful of miRNA targets have been [http://besocietal.com/members/porter10hope/activity/292751/ N adults (Lewkowicz and HansenTift, 2012; Tenenbaum et al., 2013). Similarly, Hunnius and] validated experimentally. To identify miRNA targets in foxtail millet at the worldwide level, we employed the degradome sequencing method to determine target genes for recognized miRNAs and candidate novel miRNAs. Raw sequencing information generated by degradome sequencing are obtainable at EMBL using the accession number ERP014368. After removing adapter sequences and lowquality tags, we obtained a total of 11,762,879 clean reads (three,528,168 distinctive reads) representing the 5' uncapped ends, of which 7,239,426 (two,433,599 exclusive reads) have been completely matched for the S. italica genome. The reads that completely mapped to the genome have been subjected to additional evaluation applying PAREsnip computer software [52]. Within this study, 56 target genes for 12 identified miRNA families [https://dx.doi.org/10.1038/srep43317 title= srep43317] have been identified. Depending on the abundance of degradome tags at the target websites, these cleaved targets have been classified into five categories; 42 target genes had been classified into category 0, four target genes into category 1, 6 target genes into category two, 2 target genes into category 3, and two target genes into category four (Table four). The detailed data is [http://s154.dzzj001.com/comment/html/?155142.html AesthesiaTable 5 | Voxelwise ANOVA--Group ?Condition Interaction (letters/characters). Cluster ID Volume (mm] offered in More file 8, along with the t-plots for targets are illustrated in Additional file 9. The majority of known miRNAs regulated numerous target genes (ranging from 1 to 11). Among them, the sit-miR156 family members, with 11 exceptional target genes, had the largest number of target genes; the sit-miR172 and sit-miR393 families had only a single [https://dx.doi.org/10.1089/jir.2011.0073 title= jir.2011.0073] target gene, as well as the others had two to eight targets. Functional analysis of those target genes showed that they were enriched in transcription aspects, including SBP-box transcription factor (sit-miR156), MYB (sit-miR159), ARF (sit-miR160), NAC (sit-miR164), HD-zip transcription issue (sitmiR166), GRAS (sit-miR171), and GRF (sit-miR396). These benefits have been constant with a earlier study in S. italica along with other species [8, 35]. In addition, we identified a total of 26 target genes for 9 novel miRNAs (Extra file eight, Further file ten).miRNA* sequence ATGGTGTACCGGTTGTTATGC AGGCTAGGCTTGCGACTGGAG CCGTAGCCCCTGCTCCTGATG TGACAACGAGAGAGAGCA CGTGGTGTTGTTTCGGCTCATG TTGAGCCGTGCCAATATCACG TTAGCCAAGAATGACTTGCCTATC GCTCGCTCCTCTTTCTGTCAGCpercursor place scaffold_7:35210708..35210784:scaffold_14:67096..67179:scaffold_5:4967704..4967886:scaffold_8:21627028..21627140:+ scaffold_1:34236041..34236153:+ scaffold_7:30396911..30397013:scaffold_3:6158117..6158229:+ scaffold_4:31435223..31435323:+MFE -30.two -31.four -101.4 -71.two -53.1 -50.3 -49.2 -66.Wang et al. BMC Genetics (2016) 17:Web page 7 ofFig. four Differential expression analysis of conserved and novel drought-responsive miRNAs. a Fold adjust (log2) in handle library relative to drought library detected by solexa small RNA sequencing. b The relative expression degree of miRNAs measured by RT-qPCR. * signifies significant distinction among control and drought anxiety at P 0.In contrast to the targets of identified miRNAs, most targets of novel miRNAs fell into category two. Of those 26 target genes, ten have been in category 2, six have been in category three, four were in category four, three had been in category 0 and 1. |
Версія за 15:22, 7 лютого 2018
CGAGCAC Arm 3p 5p 5p 3p 3p 5p 3p 5p Length (nt) 22 21 21 21 21 21 21In foxtail millet, numerous miRNA targets happen to be predicted previously [35, 36], but handful of miRNA targets have been N adults (Lewkowicz and HansenTift, 2012; Tenenbaum et al., 2013). Similarly, Hunnius and validated experimentally. To identify miRNA targets in foxtail millet at the worldwide level, we employed the degradome sequencing method to determine target genes for recognized miRNAs and candidate novel miRNAs. Raw sequencing information generated by degradome sequencing are obtainable at EMBL using the accession number ERP014368. After removing adapter sequences and lowquality tags, we obtained a total of 11,762,879 clean reads (three,528,168 distinctive reads) representing the 5' uncapped ends, of which 7,239,426 (two,433,599 exclusive reads) have been completely matched for the S. italica genome. The reads that completely mapped to the genome have been subjected to additional evaluation applying PAREsnip computer software [52]. Within this study, 56 target genes for 12 identified miRNA families title= srep43317 have been identified. Depending on the abundance of degradome tags at the target websites, these cleaved targets have been classified into five categories; 42 target genes had been classified into category 0, four target genes into category 1, 6 target genes into category two, 2 target genes into category 3, and two target genes into category four (Table four). The detailed data is AesthesiaTable 5 | Voxelwise ANOVA--Group ?Condition Interaction (letters/characters). Cluster ID Volume (mm offered in More file 8, along with the t-plots for targets are illustrated in Additional file 9. The majority of known miRNAs regulated numerous target genes (ranging from 1 to 11). Among them, the sit-miR156 family members, with 11 exceptional target genes, had the largest number of target genes; the sit-miR172 and sit-miR393 families had only a single title= jir.2011.0073 target gene, as well as the others had two to eight targets. Functional analysis of those target genes showed that they were enriched in transcription aspects, including SBP-box transcription factor (sit-miR156), MYB (sit-miR159), ARF (sit-miR160), NAC (sit-miR164), HD-zip transcription issue (sitmiR166), GRAS (sit-miR171), and GRF (sit-miR396). These benefits have been constant with a earlier study in S. italica along with other species [8, 35]. In addition, we identified a total of 26 target genes for 9 novel miRNAs (Extra file eight, Further file ten).miRNA* sequence ATGGTGTACCGGTTGTTATGC AGGCTAGGCTTGCGACTGGAG CCGTAGCCCCTGCTCCTGATG TGACAACGAGAGAGAGCA CGTGGTGTTGTTTCGGCTCATG TTGAGCCGTGCCAATATCACG TTAGCCAAGAATGACTTGCCTATC GCTCGCTCCTCTTTCTGTCAGCpercursor place scaffold_7:35210708..35210784:scaffold_14:67096..67179:scaffold_5:4967704..4967886:scaffold_8:21627028..21627140:+ scaffold_1:34236041..34236153:+ scaffold_7:30396911..30397013:scaffold_3:6158117..6158229:+ scaffold_4:31435223..31435323:+MFE -30.two -31.four -101.4 -71.two -53.1 -50.3 -49.2 -66.Wang et al. BMC Genetics (2016) 17:Web page 7 ofFig. four Differential expression analysis of conserved and novel drought-responsive miRNAs. a Fold adjust (log2) in handle library relative to drought library detected by solexa small RNA sequencing. b The relative expression degree of miRNAs measured by RT-qPCR. * signifies significant distinction among control and drought anxiety at P 0.In contrast to the targets of identified miRNAs, most targets of novel miRNAs fell into category two. Of those 26 target genes, ten have been in category 2, six have been in category three, four were in category four, three had been in category 0 and 1.