Five Straight Forward Specifics Of Quinapyramine Defined

Матеріал з HistoryPedia
Версія від 20:25, 25 квітня 2017, створена Iranchild1 (обговорення • внесок) (Створена сторінка: Two independent runs were conducted (each with four chains) [http://www.selleckchem.com/products/Neratinib(HKI-272).html http://www.selleckchem.com/products/Ner...)

(різн.) ← Попередня версія • Поточна версія (різн.) • Новіша версія → (різн.)
Перейти до: навігація, пошук

Two independent runs were conducted (each with four chains) http://www.selleckchem.com/products/Neratinib(HKI-272).html for 500,000 generations. The average standard deviation of split frequencies became S3I-201 mouse as follows; Ci-p53/p73-a ( Fig.?1A, a) TCGAGCAAGGACCTACCAGT and GGTCGGAAAGTTGCTCAAAC, Fig.?1.? (A) The structure of Ci-p53/p73-a. Ci-p53/p73-a produces at least five splicing variants, according to a large-scale cDNA analysis. Coding regions are marked in green and untranslated regions in white. In parentheses, names of variants of Ci-p53/p73-a from Satou et Quinapyramine al. (2008) or cDNA clone IDs (Cima833f15 and Cibd005l07) are indicated. Lines A, B and C are probes used for WISH analysis ( Fig.?2). Lines a, b, c, d, e, f and g are regions amplified for qRT-PCR. (B) A molecular phylogenetic tree of the p53 family genes. This tree was constructed using MrBayes ( Ronquist and Huelsenbeck, 2003). Posterior probabilities are shown in nodes of the tree. An alignment is available in Supplementary Fig. S1. Abbreviations are as follows: Ci, Ciona intestinalis; Dm, Drosophila melanogaster; Ce, Caenorhabditis elegans; Sp, Strongylocentrotus purpuratus; Dr, Danio rerio; Xl, Xenopus laevis; and Hs, Homo sapiens. Whole-mount in situ hybridization (WISH) was carried out as previously described (Noda and Satoh, 2008). Dig-labeled RNA probes for WISH were synthesized by in vitro transcription from cDNAs obtained by the C. intestinalis cDNA project ( Satou et al., 2002a). Microinjection of reagents was carried out as previously described (Imai et al., 2000).