Insider Enigmas Concerning JAK inhibitor Totally Exposed

Матеріал з HistoryPedia
Версія від 19:35, 21 травня 2017, створена Knot32gallon (обговорення • внесок) (Створена сторінка: pufM gene profiling Profiling of pufM genes was performed by Temporal Temperature gel Gradient Electrophoresis (TTGE) after PCR amplification using a Cy5-labele...)

(різн.) ← Попередня версія • Поточна версія (різн.) • Новіша версія → (різн.)
Перейти до: навігація, пошук

pufM gene profiling Profiling of pufM genes was performed by Temporal Temperature gel Gradient Electrophoresis (TTGE) after PCR amplification using a Cy5-labeled pufM_forward primer and a primer pufM_WAW with a 40-bp GC-clamp (CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCG) added at the 5��-end. The electrophoresis conditions were similar as described by Lehours et al. (2010). Gel images were obtained at a 100 ��m resolution using a Typhoon Trio variable mode imager (Amersham Biosciences, Piscataway, NJ). Typhoon scans were acquired using the 633 nm excitation laser and the 670 BP 30 emission filter as recommended by the manufacturer for the detection of Cy5-labeled molecules. All gels were scanned with photomultiplier tube voltages to maximize the signal without saturating fingerprint bands. Band patterns were analyzed using GELCOMPARE 6.5 software package (Applied Maths, Kortrijk, Belgium). In band assignment, a 1% band position tolerance (relative to the total length of the gel) was applied, which indicates the maximal shift allowed for two bands in different TTGE patterns to be considered as identical. Richness (number of TTGE bands in a profile) and diversity (Shannon-Wiener index) were computed as previously described (Smith and Wilson, 1996). Statistical analyses Box plots were performed using R software (version 2.15.2) available at http://cran.univ-lyon1.fr/bin/windows/base. Principal Component Analyses (PCA), Canonical Correspondence Analyses (CCA) and correlations were performed using PAST 1.81 (Hammer et al., 2001) available at http://palaeo-electronica.org/2001_1/past/issue1_01.htm. Results and discussion Brief overview of the hydrological context The PCA, including temperature, salinity and Chl a as variables, explained a huge part of the variance between stations. It mainly discriminated waters of the N/S transect from those of the E/W transect and grouped separately Arctic waters (Figure ?(Figure1B).1B). The PCA well illustrated the temperature gradient existing between stations (Figures 1B,C). Since salinity and chlorophyll a (Chl a) were locally highly variable with depth, they did not discriminate waters of Arctic or Atlantic origin (Figures 1B,D,E) as summarized below (for detailed information on the hydrological context, see Not et al., 2005). Waters of Arctic origin (stations Z18 and M09) were JAK inhibitor characterized by low temperatures (range 1.78��C�C4.78��C), low salinities (ca. 34.5 psu) (Figures 1C,D) and showed high surface Chl a concentrations (>1.4 ��g L?1 and >0.8 ��g L?1, respectively) (Figure ?(Figure1E).1E). The Atlantic-influenced waters [stations Z01 to Z15 (S/N transect) and stations Z59 to Z68 (E/W transect)] were characterized by higher surface temperatures (> 6��C) and salinities generally above 34.5 psu (Figures 1B,C). Chl a concentrations were lower (