The GPX5 Truths Your Mother And Father Doesn't Want One To Discover

HopZ1a, HopZ1aC216A and HopZ1aK289R were amplified by PCR with the iProof High-Fidelity PCR Kit (BioRad, USA), using plasmids pAME30, pAME27, and pMAM1 as templates, and primers Z1pET-F (AACATATGGGAAATGTATGCGTCG) and Z1pET-R (AAGGATCCTTAGCGCTGCTCTTCGGC). PCR-amplified DNA fragments, encoding the corresponding ORFs were digested with NdeI and BamHI and cloned into the corresponding sites of expression vector pET28a(+). The resulting vectors pET28-Z1a, pET28-C2, and pET28-K2 carry HopZ1a, HopZ1aC216A, and HopZ1aK289R as 6xHis N-terminal fusion proteins, respectively. The ORFs for 6xHis-HopZ1a, 6xHis-HopZ1aC216A, and 6xHis-HopZ1aK289R were excised from pET28-Z1a, pET28-C2, and pET28-K2 using XbaI and BamHI, and cloned into the corresponding sites of binary vector pBINX1 (Sanchez-Duran et al., 2011): the resulting vectors were designated pBINZ1, pBINZ2, and pBINZ3, respectively. Plant Protein Extraction and Western Blot Approximately 100 ��g of leaf tissue were harvested, frozen into liquid nitrogen and ground into 100 ��l of extraction buffer [10 mM Tris-HCl pH 7.4, 150 mM NaCl and EDTA-free plant protease inhibitor cocktail (Roche, Germany)]. The resulting homogenate was centrifuged at 20000 g for 10 min at 4��C. Soluble supernatant was separated and centrifuged again to ensure absence of insoluble debris. Protein concentration of the soluble supernatant was determined by the BioRad protein assay (BioRad, USA). Ten micrograms of each protein sample, unless otherwise stated, were resolved on 12% acrylamide SDS-PAGE gels (Mini protean, BioRad, USA) and transferred to PVDF membranes (Millipore, USA). Western blots for immunodetection of PR1 were carried out using standard methods, with a 1:5000 dilution of anti-PR1 antibody and 1:10000 dilution of a secondary Anti-Rabbit antibody (SIGMA, USA). Membranes were developed using the BioRad Clarity Western ECL Substrate (BioRad, USA) following instructions from the manufacturer. The anti-PR1 serum was originally described by Wang et al. (2005). Results HopZ1aK289R Suppresses Local PR1 Accumulation Triggered by DC3000 We have previously shown that HopZ1a suppresses DC3000-triggered PR1 protein accumulation, and that this suppression requires its Vorinostat research buy catalytic cysteine C216 residue (Macho et al., 2010). To analyze the potential effect of the K289R mutation on HopZ1a activity, we inoculated Arabidopsis Col-0 plants with DC3000, DC3000 expressing HopZ1a, or DC3000 expressing either the catalytically inactive HopZ1aC216A mutant or the HopZ1aK289R mutant, and compared the levels of PR1 accumulation in local tissue 48 h after infection (hpi). In keeping with our previous results (Macho et al., 2010), PR1 accumulated to similar levels in leaves inoculated with DC3000 or DC3000 expressing HopZ1aC216A, while PR1 accumulation was clearly reduced in plants inoculated with DC3000 expressing HopZ1a (Figure ?Figure11).